ID: 1173913080

View in Genome Browser
Species Human (GRCh38)
Location 20:46684713-46684735
Sequence GTACCTGCTTTGTTGGGGTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173913080_1173913087 15 Left 1173913080 20:46684713-46684735 CCATACCCCAACAAAGCAGGTAC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1173913087 20:46684751-46684773 CGTGAGGAAACTGAGGAATGAGG 0: 1
1: 0
2: 12
3: 76
4: 587
1173913080_1173913086 8 Left 1173913080 20:46684713-46684735 CCATACCCCAACAAAGCAGGTAC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1173913086 20:46684744-46684766 TAGTACACGTGAGGAAACTGAGG 0: 1
1: 0
2: 39
3: 533
4: 3566
1173913080_1173913084 -1 Left 1173913080 20:46684713-46684735 CCATACCCCAACAAAGCAGGTAC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1173913084 20:46684735-46684757 CTAGCCTTATAGTACACGTGAGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173913080 Original CRISPR GTACCTGCTTTGTTGGGGTA TGG (reversed) Exonic
900388698 1:2423603-2423625 GTCACTGACTTGTTGGGGTAAGG + Intergenic
901084228 1:6601089-6601111 CTACCTCCTTTGTCGGGGTGAGG - Intronic
901740136 1:11336265-11336287 ATGCCTGCTTTGCTGGGGAAGGG - Intergenic
902175411 1:14646517-14646539 GTATCCCCTTTGTTGGGCTATGG + Intronic
902374963 1:16026310-16026332 GACCCAGCTTTGGTGGGGTATGG - Intronic
904595037 1:31638588-31638610 GCACCTGCTTTGTTGGCCTGGGG - Intronic
909861630 1:80612715-80612737 GAACTAGTTTTGTTGGGGTAAGG + Intergenic
915094071 1:153446706-153446728 GTGTCTGCTATGTTGGGGTCTGG - Intergenic
916830422 1:168485372-168485394 GTACCTGGGTTGGTGGGGTGGGG + Intergenic
920318524 1:205098179-205098201 GTACCTGCTTTTTAGGGTTGTGG - Intronic
920669739 1:207994011-207994033 GAGCCTGCTGTGTTGGGGAAAGG + Intergenic
921161940 1:212479077-212479099 TTTGCTGCTTTGTTGGGGTGAGG + Intergenic
923363377 1:233235009-233235031 GTACCTGCCTGGTTTGGGTGAGG - Intronic
924018810 1:239758409-239758431 GCACCTTGTTTGTTGGGGTGGGG - Intronic
1063372161 10:5529044-5529066 CAACCTTCTGTGTTGGGGTAAGG + Intergenic
1063790868 10:9445421-9445443 GGCCCAGTTTTGTTGGGGTATGG + Intergenic
1072683092 10:97520797-97520819 GTTTCTGCCCTGTTGGGGTAAGG + Intronic
1072797159 10:98364878-98364900 GTACCTGCTGAGTTGGGGAGCGG + Intergenic
1075954748 10:126513312-126513334 GTACCTGTCTTGTGGGGCTATGG + Intronic
1081746560 11:45477125-45477147 GTAGCAGCAGTGTTGGGGTAAGG - Intergenic
1082899180 11:58227345-58227367 GTACCAGCCTTGCTAGGGTATGG - Intergenic
1083934689 11:65864089-65864111 GTACCTGCATTCTTGGGCTGAGG + Intronic
1084501492 11:69538170-69538192 GTCCCTGCTCTGCTGGGGTCAGG - Intergenic
1085559420 11:77457029-77457051 GTACCTGCTTTGGCTGGGTGCGG - Intronic
1085948505 11:81301333-81301355 GTAACACCTTTGTTGGGGGAAGG - Intergenic
1087136181 11:94722489-94722511 GCACATGCTTTGTAGGGCTATGG - Intronic
1088964546 11:114705031-114705053 CTACCTGCATTGTTGGGATATGG - Intronic
1090069042 11:123527539-123527561 GTCCTTGCTTTCTTGGGGTCTGG + Intronic
1092690697 12:11106998-11107020 AGACCTTCTTTTTTGGGGTAGGG + Intronic
1093638510 12:21499051-21499073 GTACCTGCTCTTTTGGGGAAGGG + Intronic
1094415873 12:30214294-30214316 GTTCCTGCTTTATGGGGCTAAGG - Intergenic
1096824506 12:54264405-54264427 GTGACTGCTTTGTGGGGGTAAGG - Intronic
1097202098 12:57287872-57287894 ATACCTGCTTTGTGGGGAAATGG + Intronic
1100705887 12:97199557-97199579 ATATTTGCTTTGTTGGGGGAAGG + Intergenic
1100761668 12:97814154-97814176 GTAACTGCGTTGTTGTGGTATGG - Intergenic
1109403100 13:61861027-61861049 GTACCTTCTTTGTTGAAGAAAGG - Intergenic
1109767195 13:66917907-66917929 GTACCTGTTTTGTAGGGGAGAGG - Intronic
1110563716 13:76937047-76937069 GTATCTGCTATGTTGGGGCAGGG + Intergenic
1112492000 13:99875037-99875059 GTACGTGCTTTGTTTGGTTTTGG + Intronic
1113272691 13:108691971-108691993 GCATCTGCTTTGTTGGGAAAGGG - Intronic
1114444891 14:22780892-22780914 GTAACTTTTTTGTTGGGGGAGGG - Intronic
1116545053 14:46154886-46154908 GTATCTGCTTTGTTGTGTGAAGG + Intergenic
1117826106 14:59705249-59705271 GTAGCTGCAAAGTTGGGGTAGGG - Intronic
1117899973 14:60521711-60521733 GTACCTGTGTAGATGGGGTAAGG - Intergenic
1121316212 14:92962437-92962459 GTACCTGCCTTGTGGGTGAACGG - Intronic
1124406570 15:29398055-29398077 GAACCTGCTTTGTGAGGGGAGGG - Intronic
1125259116 15:37801954-37801976 GTGCTTGCTTTGTTGGGTTGTGG - Intergenic
1126625765 15:50684790-50684812 GTACCTTCTCTCTTGGGGTGTGG - Intronic
1126719707 15:51565378-51565400 GAACCTGCTTTGTTTGGGCATGG - Intronic
1127452584 15:59131381-59131403 TTACCTGCTTGGTTGGGGGAGGG - Intergenic
1127932044 15:63603459-63603481 GCACCTGCTTTGTTTGGTTATGG + Intergenic
1128469863 15:67943176-67943198 GTACCAGCATTGTTGGGTTCTGG - Intergenic
1131718125 15:95135843-95135865 GCATCTTCTTTGTTGGGTTAAGG + Intergenic
1132008782 15:98255795-98255817 GTGCCTTCTTTGTAGAGGTAAGG - Intergenic
1132871871 16:2118950-2118972 GTGCCGGCTTGGTTGGGGCAGGG - Intronic
1134520656 16:14917946-14917968 GTGCCGGCTTGGTTGGGGCAGGG + Intronic
1134550919 16:15138028-15138050 GTGCCGGCTTGGTTGGGGCAGGG - Intronic
1134708328 16:16316597-16316619 GTGCCGGCTTGGTTGGGGCAGGG + Intergenic
1134715543 16:16356630-16356652 GTGCCGGCTTGGTTGGGGCAGGG + Intergenic
1134951274 16:18352048-18352070 GTGCCGGCTTGGTTGGGGCAGGG - Intergenic
1134959214 16:18395529-18395551 GTGCCGGCTTGGTTGGGGCAGGG - Intergenic
1145918029 17:28588115-28588137 ATAACTGCTTTGCTGGGGAAGGG - Intronic
1148079769 17:44961184-44961206 GTCCCTGCCTTGATGGGGGATGG + Intronic
1148174330 17:45550557-45550579 GCGCCTGCTGTGGTGGGGTAGGG + Intergenic
1148274932 17:46294890-46294912 GCGCCTGCTGTGGTGGGGTAGGG - Intronic
1148297039 17:46512469-46512491 GCGCCTGCTGTGGTGGGGTAGGG - Exonic
1148361592 17:47016949-47016971 GCGCCTGCTGTGGTGGGGTAGGG - Intronic
1148472690 17:47905301-47905323 GAAACTGCTTTGTTGGCTTACGG + Intronic
1149093859 17:52817235-52817257 GCTCCAGCTTGGTTGGGGTAGGG - Intergenic
1150405550 17:64897479-64897501 GCGCCTGCTGTGGTGGGGTAGGG + Exonic
1150602592 17:66663656-66663678 ATATCAGCTTTGTTGGGGGAGGG + Intronic
1151027713 17:70698569-70698591 GTGCCTGCTTTGTCTGGGGAAGG + Intergenic
1151645687 17:75429794-75429816 GTACCTGTTTTTTTGGCATAAGG + Intergenic
1152000467 17:77642159-77642181 CTACCTGACTTGTTGGGGCAGGG - Intergenic
1157930093 18:51812300-51812322 GGACCTGCTTTGCTGAGCTAAGG - Intergenic
1158252846 18:55508556-55508578 GTCCCTGCTTCATTGGGCTATGG - Intronic
1158657492 18:59352338-59352360 GTACCAGTTTTCTTGGGGTTAGG - Intronic
1160305532 18:77731759-77731781 GTCCCTGCTCTGTTGGGTCATGG - Intergenic
1162842917 19:13369436-13369458 GCACCTGCTTTATTGGGGGACGG - Intronic
1167273873 19:48523101-48523123 TTAACTGCTGTGCTGGGGTATGG - Intergenic
929050538 2:37832908-37832930 GTAGCTGCTTTGTTTGGGGAAGG - Intergenic
932751754 2:74375753-74375775 GTACTTGCTTTGGTAGGGAATGG - Intronic
935845717 2:107163618-107163640 GTAAATGCTTTGTTGTGGTTAGG - Intergenic
938389455 2:130893523-130893545 TTTTCTGCTTTGTTGGGGCACGG + Intronic
940565160 2:155351378-155351400 GTTCCAGCTTGGTTGGGGGAGGG - Intergenic
940668631 2:156639982-156640004 GTAACTGCTTGGCTGGGGAATGG - Intergenic
941252836 2:163187409-163187431 ATCCCTGCTTTGTTTGGGTATGG - Intergenic
941408054 2:165116861-165116883 GTACCTCCTAGGTTGGAGTATGG + Intronic
943062581 2:183053755-183053777 GTACCTACTTTGTTGGGAACAGG - Intergenic
944975321 2:205043298-205043320 TTACCTACTTTTTTGGGGGAGGG + Intronic
945323265 2:208451967-208451989 TTAACTGCTTTGTTAGGTTAGGG + Intronic
1169000274 20:2163356-2163378 GTCCCTGCTTTGTTGGCACATGG + Intronic
1169656892 20:7934219-7934241 GTACCTGCCTCATTGGGTTATGG - Intronic
1169875826 20:10295989-10296011 GTAGCTTCTTTGTTGGGCTGAGG - Intronic
1172224803 20:33298321-33298343 GTATCTGCTATGCTGGGGGAGGG - Intronic
1173913080 20:46684713-46684735 GTACCTGCTTTGTTGGGGTATGG - Exonic
1174497273 20:50956824-50956846 GTAGCTGCTTTGAAGTGGTAGGG - Intronic
1176988913 21:15470529-15470551 GTAGCTGCTTTTTAGGGTTAAGG - Intergenic
1180999586 22:19981783-19981805 GAAACTGCTTTGCTGGGGTCTGG + Intronic
1183492221 22:38122776-38122798 GTGCCTGCTTTGCAGGGGTGAGG + Intronic
950398665 3:12753623-12753645 GAAGCTTCTCTGTTGGGGTAGGG - Intronic
951222533 3:20083908-20083930 GCACCTATTTTGTTGGGATAGGG + Intronic
954368917 3:50160184-50160206 GGACCTGCTCTCTTGGGGTGTGG + Intronic
956380833 3:68662835-68662857 GTACCAGCATGGTTGGGGTCTGG - Intergenic
959644809 3:108686566-108686588 GTACCTGGTTTGCTGTGGAAAGG - Exonic
960773150 3:121217024-121217046 GTGCCAGCTTGGTTGGGGGAGGG - Intronic
961570043 3:127791052-127791074 GTGCATGCTTAGTTAGGGTATGG + Intronic
965130850 3:164698339-164698361 TTACATGCATTGTTGGGATAAGG - Intergenic
965618860 3:170622388-170622410 ATCCCTGCTTTTTTGGGGTCAGG + Intronic
966680425 3:182636646-182636668 TTACCTGCTGTGTTGAGGGAAGG + Intergenic
968126529 3:196164184-196164206 GCACCTGCTCTGTGGGGCTAGGG + Intergenic
969424667 4:7117214-7117236 GGACCTCCAGTGTTGGGGTAAGG + Intergenic
974146518 4:57954299-57954321 GTGTCTGCATTATTGGGGTAAGG + Intergenic
975033488 4:69653450-69653472 ATACTTGGTTAGTTGGGGTAGGG - Intergenic
975732096 4:77347429-77347451 GTACGTGACTTGTTGGGGTGGGG + Intronic
990041713 5:51384679-51384701 GTACATGCTTTGTTAGGGATGGG + Exonic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
994109180 5:95981108-95981130 TTCCCTGCTTTGCTGGGGTGGGG - Intergenic
995089692 5:108159590-108159612 GTGCCAGCATTGTTGGGGTCTGG - Intronic
999590434 5:153139152-153139174 GTACCAGCTTGGTTGGGTCATGG - Intergenic
1001806588 5:174591970-174591992 GTACATGGTGTGTTGGGGAAGGG - Intergenic
1002822709 6:741852-741874 GTAGCTGGTTTGTTGTGGTCTGG + Intergenic
1003829544 6:9992859-9992881 GTAACTGATTTGTTGCTGTATGG - Intronic
1007700174 6:43761782-43761804 GTACCTGCTATGTTGGGTGTGGG + Intergenic
1010687428 6:78868939-78868961 GGACTTGCTTTTTCGGGGTATGG - Intronic
1012520920 6:100120194-100120216 GCACCTTCTTTGTTGGGGCTGGG + Intergenic
1019209476 6:170393806-170393828 GCACCTCCTGTGTTGGGGAAGGG + Intronic
1019988949 7:4679112-4679134 GTACCTGCTTGATTGAGGTGGGG - Intergenic
1022371738 7:29777748-29777770 GAGCCTGCTTTGTGGGGGTGGGG + Intergenic
1027469872 7:78560072-78560094 GTCCCTGCTTTGTGTGGGCATGG - Intronic
1033036311 7:137879292-137879314 CACCCTGCTTTGTTGAGGTAGGG + Exonic
1033617662 7:143032312-143032334 GATCCAGCTTGGTTGGGGTAGGG + Intergenic
1034549502 7:151811290-151811312 GTACCTGCCTTGCAGGAGTAAGG - Intronic
1034632248 7:152539581-152539603 GCACCTGCTTTAGTGGGGTGCGG - Intergenic
1035527587 8:325767-325789 GTCCCTGCTGTGTGGGGGTGAGG - Intergenic
1036505075 8:9347618-9347640 GTCCCTGTTATCTTGGGGTACGG + Intergenic
1038280704 8:26161593-26161615 GTACCTGGGTTGTAGGGGAAGGG + Intergenic
1039235337 8:35496799-35496821 ATAGCTGCTTTGTAGGGCTAGGG - Intronic
1039253895 8:35697472-35697494 CAACTTGTTTTGTTGGGGTAGGG - Intronic
1041389951 8:57339301-57339323 GTAGCTGGTTTCATGGGGTAGGG + Intergenic
1041460561 8:58107045-58107067 GTCCCTGCTTTGTGAGGTTATGG - Intronic
1044432020 8:92119280-92119302 GTACTTGCTTTGTTTGTGAAGGG - Intergenic
1045685211 8:104704404-104704426 GCACTTGCTTTGTTGGGGCATGG - Intronic
1045981194 8:108190261-108190283 GTACCTACTTTGTAGGGCTGTGG - Intergenic
1048219579 8:132529087-132529109 GTACCTGCCTTGTGGGGCTTTGG - Intergenic
1049663823 8:143834046-143834068 GAACCTCTTTTGTTGGGGAAGGG - Exonic
1052330581 9:27263537-27263559 CTTCCTGGTTTGTTGGGGTATGG + Intergenic
1054873209 9:70068339-70068361 GCACCTCCTCTGTGGGGGTAGGG + Intronic
1062056680 9:134472604-134472626 GTGCCTGCCTTGGTGGGGCAGGG + Intergenic
1189255806 X:39638094-39638116 GTAACTGGTTTGTTGGTGGATGG + Intergenic
1190163829 X:48055105-48055127 GTTCCTGCTTTGTGGGGACATGG - Intronic
1190516857 X:51232796-51232818 GGAGCTGCTTTGTGGGGGCATGG + Intergenic
1191701599 X:64048049-64048071 GTACCTGCTGTGTTAGGTTGTGG + Intergenic
1191858883 X:65649796-65649818 TTCCTTGCTTTGGTGGGGTAGGG - Intronic
1195705596 X:107735932-107735954 TTCCCTGCTTTTTTGGGGTGAGG + Intronic
1197782954 X:130174915-130174937 GTAAATGCTTTGATGGGGTGAGG - Intronic
1199439162 X:147848856-147848878 GTGCCTGCTATGGTGGGGCATGG + Intergenic