ID: 1173915480

View in Genome Browser
Species Human (GRCh38)
Location 20:46705177-46705199
Sequence AGTCAGGAGTTAGAGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173915474_1173915480 23 Left 1173915474 20:46705131-46705153 CCTATAGTCTTTGCTACTCAGAA No data
Right 1173915480 20:46705177-46705199 AGTCAGGAGTTAGAGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173915480 Original CRISPR AGTCAGGAGTTAGAGGCTGA AGG Intergenic
No off target data available for this crispr