ID: 1173915892

View in Genome Browser
Species Human (GRCh38)
Location 20:46708847-46708869
Sequence GGGGTGGGAAGGAGCTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173915892_1173915909 18 Left 1173915892 20:46708847-46708869 CCCCATAAGCTCCTTCCCACCCC No data
Right 1173915909 20:46708888-46708910 GTTCCCCCTGCGGGGAATGCCGG No data
1173915892_1173915905 8 Left 1173915892 20:46708847-46708869 CCCCATAAGCTCCTTCCCACCCC No data
Right 1173915905 20:46708878-46708900 TGCCTTTGCTGTTCCCCCTGCGG No data
1173915892_1173915908 10 Left 1173915892 20:46708847-46708869 CCCCATAAGCTCCTTCCCACCCC No data
Right 1173915908 20:46708880-46708902 CCTTTGCTGTTCCCCCTGCGGGG No data
1173915892_1173915906 9 Left 1173915892 20:46708847-46708869 CCCCATAAGCTCCTTCCCACCCC No data
Right 1173915906 20:46708879-46708901 GCCTTTGCTGTTCCCCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173915892 Original CRISPR GGGGTGGGAAGGAGCTTATG GGG (reversed) Intergenic
No off target data available for this crispr