ID: 1173920640

View in Genome Browser
Species Human (GRCh38)
Location 20:46742358-46742380
Sequence GTGCTAGGACAGAGGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173920628_1173920640 23 Left 1173920628 20:46742312-46742334 CCTTAACATTAAATCAGCCTGGA No data
Right 1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG No data
1173920632_1173920640 -4 Left 1173920632 20:46742339-46742361 CCCCTTGCTGGCCAGAGAGGTGC No data
Right 1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG No data
1173920634_1173920640 -6 Left 1173920634 20:46742341-46742363 CCTTGCTGGCCAGAGAGGTGCTA No data
Right 1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG No data
1173920633_1173920640 -5 Left 1173920633 20:46742340-46742362 CCCTTGCTGGCCAGAGAGGTGCT No data
Right 1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG No data
1173920630_1173920640 6 Left 1173920630 20:46742329-46742351 CCTGGATGAGCCCCTTGCTGGCC No data
Right 1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173920640 Original CRISPR GTGCTAGGACAGAGGATGGG AGG Intergenic
No off target data available for this crispr