ID: 1173924435

View in Genome Browser
Species Human (GRCh38)
Location 20:46770342-46770364
Sequence CTTTATTAGCAGCATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173924435_1173924437 -7 Left 1173924435 20:46770342-46770364 CCATCCTCATGCTGCTAATAAAG No data
Right 1173924437 20:46770358-46770380 AATAAAGACATACCCAAGACTGG 0: 851
1: 2918
2: 5260
3: 7049
4: 8377
1173924435_1173924441 7 Left 1173924435 20:46770342-46770364 CCATCCTCATGCTGCTAATAAAG No data
Right 1173924441 20:46770372-46770394 CAAGACTGGGTAATTTATAAAGG 0: 1394
1: 2501
2: 4118
3: 3674
4: 2254
1173924435_1173924442 14 Left 1173924435 20:46770342-46770364 CCATCCTCATGCTGCTAATAAAG No data
Right 1173924442 20:46770379-46770401 GGGTAATTTATAAAGGAAAGAGG 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
1173924435_1173924443 22 Left 1173924435 20:46770342-46770364 CCATCCTCATGCTGCTAATAAAG No data
Right 1173924443 20:46770387-46770409 TATAAAGGAAAGAGGTTTAATGG 0: 699
1: 1035
2: 1698
3: 1828
4: 1728
1173924435_1173924438 -6 Left 1173924435 20:46770342-46770364 CCATCCTCATGCTGCTAATAAAG No data
Right 1173924438 20:46770359-46770381 ATAAAGACATACCCAAGACTGGG 0: 2136
1: 4078
2: 7251
3: 8542
4: 9456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173924435 Original CRISPR CTTTATTAGCAGCATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr