ID: 1173924558

View in Genome Browser
Species Human (GRCh38)
Location 20:46771190-46771212
Sequence TATCCAAAGCTGATAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173924557_1173924558 2 Left 1173924557 20:46771165-46771187 CCAGCATTATTGTAATCGTTGCT No data
Right 1173924558 20:46771190-46771212 TATCCAAAGCTGATAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173924558 Original CRISPR TATCCAAAGCTGATAGAAAC AGG Intergenic
No off target data available for this crispr