ID: 1173927196

View in Genome Browser
Species Human (GRCh38)
Location 20:46789630-46789652
Sequence GGGGCAGCCACAGACTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173927196_1173927200 -2 Left 1173927196 20:46789630-46789652 CCTACACAGTCTGTGGCTGCCCC No data
Right 1173927200 20:46789651-46789673 CCACTTCCCTTCTGACCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173927196 Original CRISPR GGGGCAGCCACAGACTGTGT AGG (reversed) Intergenic
No off target data available for this crispr