ID: 1173927567

View in Genome Browser
Species Human (GRCh38)
Location 20:46792199-46792221
Sequence CCAGATAAGGTGAGGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173927567_1173927578 8 Left 1173927567 20:46792199-46792221 CCCTCCCGCCTCACCTTATCTGG No data
Right 1173927578 20:46792230-46792252 CCTGCCTTCCAACCTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173927567 Original CRISPR CCAGATAAGGTGAGGCGGGA GGG (reversed) Intergenic
No off target data available for this crispr