ID: 1173927708

View in Genome Browser
Species Human (GRCh38)
Location 20:46793031-46793053
Sequence GTCACCCAGAGGGCCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173927708_1173927715 18 Left 1173927708 20:46793031-46793053 CCCACTGGGGCCCTCTGGGTGAC No data
Right 1173927715 20:46793072-46793094 ATCTCGAAGCTACCCCATCTGGG No data
1173927708_1173927714 17 Left 1173927708 20:46793031-46793053 CCCACTGGGGCCCTCTGGGTGAC No data
Right 1173927714 20:46793071-46793093 CATCTCGAAGCTACCCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173927708 Original CRISPR GTCACCCAGAGGGCCCCAGT GGG (reversed) Intergenic