ID: 1173928635

View in Genome Browser
Species Human (GRCh38)
Location 20:46799845-46799867
Sequence GGGTCTCACTGAGACCTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173928631_1173928635 1 Left 1173928631 20:46799821-46799843 CCATGCAGATCAAGTAGAGAAGA No data
Right 1173928635 20:46799845-46799867 GGGTCTCACTGAGACCTAGGCGG No data
1173928630_1173928635 12 Left 1173928630 20:46799810-46799832 CCTGCTGATCTCCATGCAGATCA No data
Right 1173928635 20:46799845-46799867 GGGTCTCACTGAGACCTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173928635 Original CRISPR GGGTCTCACTGAGACCTAGG CGG Intergenic
No off target data available for this crispr