ID: 1173928985

View in Genome Browser
Species Human (GRCh38)
Location 20:46802812-46802834
Sequence AGTGGGCATGCGTGAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173928985_1173928990 5 Left 1173928985 20:46802812-46802834 CCTGCAGTTCACGCATGCCCACT No data
Right 1173928990 20:46802840-46802862 GATGGGATAATGCCTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173928985 Original CRISPR AGTGGGCATGCGTGAACTGC AGG (reversed) Intergenic
No off target data available for this crispr