ID: 1173933135

View in Genome Browser
Species Human (GRCh38)
Location 20:46838376-46838398
Sequence ACCTCTTAAGACTCAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173933135_1173933136 4 Left 1173933135 20:46838376-46838398 CCAGAGCTTGAGTCTTAAGAGGT No data
Right 1173933136 20:46838403-46838425 AGCTTCTGCTTTCACCTTCTTGG No data
1173933135_1173933138 27 Left 1173933135 20:46838376-46838398 CCAGAGCTTGAGTCTTAAGAGGT No data
Right 1173933138 20:46838426-46838448 AAACTCCAGACTACCATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173933135 Original CRISPR ACCTCTTAAGACTCAAGCTC TGG (reversed) Intergenic
No off target data available for this crispr