ID: 1173935203

View in Genome Browser
Species Human (GRCh38)
Location 20:46855744-46855766
Sequence ACTTAGATGAGGGGGTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173935197_1173935203 14 Left 1173935197 20:46855707-46855729 CCTTCCAGTCTTCTTTTGGCAAT No data
Right 1173935203 20:46855744-46855766 ACTTAGATGAGGGGGTTCAGAGG No data
1173935198_1173935203 10 Left 1173935198 20:46855711-46855733 CCAGTCTTCTTTTGGCAATACGC No data
Right 1173935203 20:46855744-46855766 ACTTAGATGAGGGGGTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173935203 Original CRISPR ACTTAGATGAGGGGGTTCAG AGG Intergenic