ID: 1173935379

View in Genome Browser
Species Human (GRCh38)
Location 20:46857588-46857610
Sequence GAGCCAGATGTGGAAAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173935376_1173935379 -10 Left 1173935376 20:46857575-46857597 CCTGGACGCACAGGAGCCAGATG No data
Right 1173935379 20:46857588-46857610 GAGCCAGATGTGGAAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173935379 Original CRISPR GAGCCAGATGTGGAAAGGTG AGG Intergenic
No off target data available for this crispr