ID: 1173938577

View in Genome Browser
Species Human (GRCh38)
Location 20:46890545-46890567
Sequence GCTTCCAGGCAGCCACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173938577_1173938579 18 Left 1173938577 20:46890545-46890567 CCTTGCAGTGGCTGCCTGGAAGC No data
Right 1173938579 20:46890586-46890608 TTCTCCACTGACAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173938577 Original CRISPR GCTTCCAGGCAGCCACTGCA AGG (reversed) Intergenic
No off target data available for this crispr