ID: 1173938579

View in Genome Browser
Species Human (GRCh38)
Location 20:46890586-46890608
Sequence TTCTCCACTGACAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173938577_1173938579 18 Left 1173938577 20:46890545-46890567 CCTTGCAGTGGCTGCCTGGAAGC No data
Right 1173938579 20:46890586-46890608 TTCTCCACTGACAAGTGTCCAGG No data
1173938578_1173938579 4 Left 1173938578 20:46890559-46890581 CCTGGAAGCTCAGCATCTAATTC No data
Right 1173938579 20:46890586-46890608 TTCTCCACTGACAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173938579 Original CRISPR TTCTCCACTGACAAGTGTCC AGG Intergenic
No off target data available for this crispr