ID: 1173939995

View in Genome Browser
Species Human (GRCh38)
Location 20:46902581-46902603
Sequence CAGGGCAGACAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 7, 3: 79, 4: 582}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173939995_1173940001 22 Left 1173939995 20:46902581-46902603 CCTTTCTCCATCTGTCTGCCCTG 0: 1
1: 0
2: 7
3: 79
4: 582
Right 1173940001 20:46902626-46902648 TTTCCACTTGCATTGCCTTATGG 0: 1
1: 0
2: 0
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173939995 Original CRISPR CAGGGCAGACAGATGGAGAA AGG (reversed) Intronic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900553513 1:3268648-3268670 TAAGGCAGACAGCTGGGGAAGGG - Intronic
901259379 1:7860440-7860462 GAGGCCAGAAAGATGCAGAAGGG + Intergenic
901422736 1:9162075-9162097 CAGGTCAGACAGGTGGAGCCAGG - Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902385308 1:16072785-16072807 CAGGTCAGACACAGAGAGAAAGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902758426 1:18564959-18564981 CAGAGCAGCCAGCTGTAGAATGG + Intergenic
902845391 1:19106477-19106499 CAGTGCAGACACATGGTGAGGGG + Intronic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903321735 1:22547467-22547489 CGGGGGAGAGAGATGGAGAGAGG - Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903669283 1:25025961-25025983 CAGGGCAGAAAGTTGGAAATGGG - Intergenic
904773565 1:32893965-32893987 CAGGGCAGACCCGGGGAGAAGGG - Exonic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905272540 1:36796325-36796347 AAAGGCAGACAGATGGAGCCTGG + Exonic
906192688 1:43908197-43908219 CAAGCCAGACAGATTTAGAAGGG - Intronic
906414219 1:45607431-45607453 CAGGACAGTGAAATGGAGAAGGG + Exonic
906674964 1:47686998-47687020 CAAGACAGACACATGGAGACAGG + Intergenic
906929634 1:50156439-50156461 CTGGGCCAACAGATGGATAAAGG + Intronic
906976650 1:50581567-50581589 CTGGGAAGACATATGTAGAATGG + Intronic
907007149 1:50926425-50926447 AAGGGCAGTGAGAGGGAGAATGG + Intronic
907841799 1:58165363-58165385 TATGGCAAACAGATGGAGAGAGG - Intronic
908013716 1:59810119-59810141 GAGGGAAGAAAGAGGGAGAAAGG - Intergenic
908292192 1:62679071-62679093 CAGGGCAGATTAATGGGGAAAGG + Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909574239 1:77155819-77155841 GAAGGCAGAAAGGTGGAGAAGGG + Intronic
910092413 1:83480746-83480768 AAGGGCATACAGAGGGAGACTGG - Intergenic
910095406 1:83516060-83516082 TAAGGCAGAAAGATTGAGAATGG + Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911398096 1:97337442-97337464 CAGGGCAGAAGGATGGAGAGTGG - Intronic
911671643 1:100614764-100614786 CAGGGCAGCAAGAAGGACAAGGG + Intergenic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912452990 1:109778787-109778809 CAGAGGAGACAAATGGAGACTGG - Intergenic
912497596 1:110101559-110101581 CAGGGCAGAGCGAGGGTGAAAGG - Intergenic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912681928 1:111734240-111734262 AGGGGCAGACAGATGGAGAGGGG + Intronic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915399439 1:155611642-155611664 TAGAGCAGAAACATGGAGAAAGG + Intronic
915416552 1:155747222-155747244 TAGAGCAGAAACATGGAGAAAGG + Intergenic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
916472479 1:165137723-165137745 CAGCTCTGACAGATGGACAAAGG - Intergenic
916527705 1:165627241-165627263 CAGGGGAGAAAGATGTAGACTGG - Intergenic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917193807 1:172445827-172445849 GAGGGCAGAGAGAAAGAGAAAGG + Intronic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918359416 1:183740400-183740422 CATGGCTTACAGATGGAGCATGG + Intronic
919246454 1:194993355-194993377 TAGGGCATAAAGATTGAGAAAGG - Intergenic
919925537 1:202189994-202190016 CAGGGAGGGCATATGGAGAAAGG + Intergenic
919977162 1:202620180-202620202 CTGGGCAGACAGAAGGACAGCGG - Intronic
920301387 1:204991248-204991270 ATGGCCAGACAGAGGGAGAAAGG - Intronic
920386711 1:205575066-205575088 CAGGCCAGGCTGATGGGGAAGGG - Intronic
920584749 1:207146679-207146701 GTGGGCAGTAAGATGGAGAAGGG + Intergenic
921009119 1:211123633-211123655 GAAGACAGACAGATGGAGAAAGG + Intronic
921186818 1:212677660-212677682 CAGTGCAGAGAGCTGGAGACAGG + Intergenic
921274238 1:213502247-213502269 CTGGGATGACAGATTGAGAATGG + Intergenic
921343487 1:214157813-214157835 CAGGGAAGAAAGATAAAGAAAGG + Intergenic
923356600 1:233162165-233162187 GAATGCAGATAGATGGAGAATGG + Intronic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
924455025 1:244212475-244212497 CAGGGCAGACAGACAAAGAGTGG + Intergenic
924518283 1:244783979-244784001 CAGAGCAGGCACTTGGAGAATGG + Intergenic
924732840 1:246727806-246727828 CATGGCAGAGAGGTGGAGAGTGG + Intronic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
924830206 1:247586065-247586087 GAGGGCAGAGAAAGGGAGAAGGG + Intergenic
924934523 1:248756763-248756785 CATGGGAGAAAGATGGAGACTGG + Intergenic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064272591 10:13878909-13878931 CAGGACAGACAGATGAGGCAGGG + Intronic
1064693219 10:17939266-17939288 CAGTTCAGAGAAATGGAGAACGG + Intergenic
1064749453 10:18511776-18511798 GAGGGCACCCAGATTGAGAAGGG + Intronic
1066639862 10:37544933-37544955 CAGGGCTGAAAGATAAAGAAAGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067730272 10:48805550-48805572 CAGGGCTGAGAGTTGGGGAAAGG + Intronic
1068632765 10:59314662-59314684 AAGGGGAGAAAGATTGAGAAGGG - Intronic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1068926660 10:62546894-62546916 CAGGTCAGAAAGAAAGAGAAGGG + Intronic
1069372992 10:67766785-67766807 CAGAGCAGAAAGATGGAAAGAGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069894342 10:71671329-71671351 CAGGCCAGCCAGATGGTGACAGG - Intronic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1071315957 10:84398241-84398263 GAAGACAGACAGAAGGAGAATGG - Intronic
1071416310 10:85444973-85444995 CAGGCCTGGCTGATGGAGAATGG - Intergenic
1071526572 10:86363002-86363024 CAAGGCAGAGGGAAGGAGAAGGG + Intronic
1071730886 10:88247336-88247358 GAAGGCAGTCAGATGAAGAAGGG + Intergenic
1072315078 10:94194474-94194496 CCGGGTAGACAGATGTAAAAGGG - Intronic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532358 10:114306031-114306053 GAGGGGACACAGATGCAGAAGGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076084784 10:127617689-127617711 CTGGGCAGAAAGGTGGAGAATGG + Intergenic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076316428 10:129545002-129545024 CAGGCCAGACAGACGAAGCAGGG - Intronic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078402857 11:11043773-11043795 AAGGGCACACAGCTGGAGAGTGG + Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079332442 11:19544989-19545011 CAGGGTAGAGAGGTGGAGAGTGG - Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1080695937 11:34603043-34603065 CAGGGAAGACAAGAGGAGAAGGG - Intergenic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083271517 11:61575216-61575238 CATGGCTGACTGAAGGAGAAAGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1084008743 11:66336280-66336302 CAGGGCAGCCAGGTGGGGCAGGG - Intronic
1084651441 11:70491770-70491792 GAGGGCACACAGCTGGAAAAGGG - Intronic
1086004863 11:82026390-82026412 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1087397675 11:97622287-97622309 CAGAGCTGACAGATGGACAGAGG - Intergenic
1087499690 11:98933963-98933985 CAGGGCAAGAACATGGAGAAAGG + Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088407282 11:109496075-109496097 CATGGCAGAAAGATGTAGACTGG + Intergenic
1088674639 11:112180642-112180664 AAGGGCAGAAAGGTGGCGAAGGG + Intronic
1089076082 11:115739948-115739970 CAGGGCAGGCAGACTCAGAAGGG - Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090280999 11:125455854-125455876 CAGAGCAGCCGGATAGAGAAGGG - Exonic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090467588 11:126948775-126948797 CAAGGCAGACAGCTGGATATGGG + Intronic
1091110333 11:132960589-132960611 GAAGACAGACAGATGGAGAGGGG - Intronic
1091372504 11:135072731-135072753 CAGGGCAGCCAAATGGAGACAGG + Intergenic
1091541352 12:1465656-1465678 CAGGGGAGTCAAGTGGAGAATGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092607125 12:10132795-10132817 CAGGGCAGAAAGACGGGGAAAGG - Intergenic
1092917130 12:13199183-13199205 CTGGGCAGACCGCTGGGGAAAGG + Intronic
1093290016 12:17308473-17308495 CAGGGAAGAGAAGTGGAGAAGGG - Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093913358 12:24772509-24772531 AAGGACAGAAAGATGAAGAAAGG + Intergenic
1094209582 12:27874917-27874939 TCGGGAAGACAGATGTAGAATGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095116729 12:38363073-38363095 CAGGACAGTCTGATGGAGACTGG - Intergenic
1096811441 12:54172933-54172955 ACGGGCACACAGGTGGAGAAAGG + Intronic
1097263286 12:57731701-57731723 TAGGGAAGATAGATGAAGAAGGG + Intronic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1098437329 12:70481766-70481788 CAGGACAGTGATATGGAGAAGGG + Intergenic
1098882142 12:75927484-75927506 CAGGGCAGACAGAGAGCAAAGGG + Intergenic
1098988195 12:77035252-77035274 CAGGGCAGAATGCTGGAGAGGGG + Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099681714 12:85837248-85837270 CAGGGCAGAGGAATGGAGATGGG + Intergenic
1100569877 12:95837496-95837518 GAGGGAAGAGAGATGGAGAGAGG + Intergenic
1100782764 12:98046997-98047019 AAGGGGAGAGAGATGGAGAGAGG + Intergenic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101344978 12:103878562-103878584 GATGCCAGACAGATGGGGAAGGG - Intergenic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1103328400 12:120137032-120137054 CATGGCAGTCAGATGGGGACAGG - Intronic
1103921512 12:124401862-124401884 GAGTGCAGCCAGCTGGAGAAAGG - Intronic
1104310933 12:127653797-127653819 GAGGGCACAAAGATGGAGAAAGG + Intergenic
1104380323 12:128301688-128301710 CTTGGCAAACAGATGCAGAATGG + Intronic
1104677063 12:130718379-130718401 CAGGCCACACAGATGGAGTCAGG - Intergenic
1104690081 12:130819048-130819070 CAGGGCAGAGAGGTGGACGAAGG - Intronic
1105865990 13:24460340-24460362 CGTGGCAGGCAGATGGAGAGGGG + Intronic
1106107245 13:26743242-26743264 CCCGGCAGAGAGATGGAGAAGGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106404379 13:29461181-29461203 CAGGACAGAGAGAGAGAGAAGGG + Intronic
1106685867 13:32057998-32058020 CAGGCCACACAGAAGCAGAAAGG + Intronic
1106969842 13:35126207-35126229 CAGGGCAGGAAGATGGAGTGAGG - Intronic
1107165001 13:37273417-37273439 GAAGGAAGACAGATGGAGAAAGG - Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1109168982 13:59073015-59073037 CAGGGGAGAAAGGTGGAAAAGGG - Intergenic
1110205786 13:72911372-72911394 CAAAGCAAACAAATGGAGAAAGG + Intronic
1111282740 13:86048842-86048864 CAGGGGAGAAAGATGTAGACTGG + Intergenic
1111394437 13:87646739-87646761 CAGGGAAGACAGTGGGTGAAGGG + Intergenic
1111397575 13:87685081-87685103 AAGGTCAGACACATGGAAAATGG + Exonic
1112058459 13:95713225-95713247 TAGGGCATAAAGATTGAGAAAGG + Intronic
1113066321 13:106376821-106376843 CAAGGGAGACAGATGGATTAGGG - Intergenic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1113627028 13:111855018-111855040 GAGGGCACCCAGATGGAGAGGGG + Intergenic
1113673922 13:112195566-112195588 CAGGGCAGAGAGACTGTGAAAGG - Intergenic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114994920 14:28336763-28336785 GAGGGCAGAGAGTTGGAGAAGGG + Intergenic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1116444358 14:44991327-44991349 CAGTGCTGACAGAAGGAGACTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118105115 14:62649985-62650007 CAGGGCACACATATGCAGAGTGG + Intergenic
1118477094 14:66127765-66127787 CAGGGCAGACAGATCGCATATGG - Intergenic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119430681 14:74566547-74566569 CTGGCCAGACAGGAGGAGAAAGG - Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1120618106 14:86732530-86732552 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1120824508 14:88943276-88943298 CAGGGCAGACTCATGGAGAAGGG - Intergenic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121081196 14:91109659-91109681 CAGGGCAGAGAAAGAGAGAAAGG + Intronic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121113873 14:91330437-91330459 CAGGACAGACAGAGGCAGACTGG + Intronic
1122899987 14:104778428-104778450 CAGGGCAGCCTGATAGAGTAGGG - Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123655030 15:22508307-22508329 CAGTGCAGAGGGATGGAAAAAGG + Intergenic
1124492825 15:30168564-30168586 CTGGGCAGACAGAAGGACAGTGG - Intergenic
1124556510 15:30730958-30730980 CAAGGCAGAAAGAAGGGGAAAGG + Intronic
1124750709 15:32369761-32369783 CTGGGCAGACAGAAGGACAGTGG + Intergenic
1125213374 15:37240725-37240747 AAGGGCAGAGATACGGAGAAGGG + Intergenic
1125680844 15:41529375-41529397 CAGGGCACACAGAAGGTCAAAGG + Intronic
1125881927 15:43202649-43202671 CAGGGTAGACACATGGAAAGAGG + Intronic
1126690791 15:51287599-51287621 CAGGGCAGAGGGAGGGGGAAAGG - Intronic
1127942477 15:63713463-63713485 CAGGGCACACCGATGGATCACGG + Exonic
1128542117 15:68543502-68543524 CAGGGTAGAAAGATGGGGATTGG - Intergenic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1129496533 15:75987552-75987574 CATGGCAGAGAGAGGGAGAGCGG - Intronic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1129535842 15:76313117-76313139 GAGGGCTGTCAGATGGGGAAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131373475 15:91903982-91904004 CAGGACACAGTGATGGAGAAAGG + Intronic
1131688639 15:94801485-94801507 CAGTCCAGAGAGATAGAGAAGGG - Intergenic
1133718172 16:8469169-8469191 CAGAGCAGACACATGGAAAGAGG - Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133841769 16:9416548-9416570 CATTGCAGAGAGAGGGAGAATGG + Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134444866 16:14323090-14323112 GAGGGCAGACAGGTAGAAAAAGG - Intergenic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136082308 16:27860207-27860229 CAGGGCAGGCAGGTGCAGACTGG - Intronic
1136492780 16:30621310-30621332 CTGGGCAAACAGATAGAAAAGGG - Intronic
1137030518 16:35519579-35519601 CTGGGCAAACAGATAGAAAAGGG + Intergenic
1137340014 16:47592348-47592370 CAGGCCAGCCAGATCGGGAAGGG - Intronic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137716604 16:50601990-50602012 AAGGGCAGAGAGATGGAAAGAGG - Intronic
1137779633 16:51087104-51087126 AAGGGCAGGCAGACAGAGAAAGG - Intergenic
1137833989 16:51572925-51572947 GAGGGCAGCAAGATGGCGAAAGG + Intergenic
1138074835 16:54031878-54031900 ATGGGCAGACAGATGGAAAGAGG + Intronic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1139048681 16:63096323-63096345 CACGGGAGAAAGATGGAGACCGG - Intergenic
1139214904 16:65118133-65118155 CCATGCAGACAGTTGGAGAAGGG + Intronic
1139313068 16:66043305-66043327 TTGGTCAGAGAGATGGAGAAAGG + Intergenic
1139594418 16:67949761-67949783 CAGGGCAGGGGGATGGGGAAAGG - Intronic
1140171992 16:72615418-72615440 CCAGGCAGACAGATGTATAATGG - Intergenic
1140217788 16:73022338-73022360 CCAGGCAGGCAGATGGTGAAAGG + Intronic
1140221016 16:73044006-73044028 CAGGCCACTCAGATTGAGAAAGG - Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140617787 16:76688165-76688187 CAAGCCAGAGAGAGGGAGAAAGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1141489733 16:84364286-84364308 CAGAGCAGACATTTTGAGAAAGG + Intergenic
1141799726 16:86298573-86298595 CATTGCAGAAAGAGGGAGAAAGG + Intergenic
1142748716 17:1974646-1974668 CAGGGAAGCCAGGTGGAGACGGG + Intronic
1143116327 17:4583867-4583889 AAGGGCAGACAGAGAAAGAAGGG - Intergenic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1145052814 17:19676912-19676934 TGGGGCAGACAGATGGTGGATGG + Exonic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1145918048 17:28588267-28588289 CATGGCATGCTGATGGAGAATGG + Intronic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146608028 17:34278771-34278793 AAGGGCAGCCAGAGAGAGAAAGG + Intergenic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1147299825 17:39517455-39517477 CAGGCCACACAGCTGGACAAGGG - Exonic
1147609282 17:41792196-41792218 CATGGCAGCCCCATGGAGAACGG - Intergenic
1147632756 17:41942691-41942713 CAGGGCAGAAAGATGTGGCAGGG + Intronic
1147668446 17:42163388-42163410 CAGAGCAGACAGAGGGGGACTGG + Intronic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1147961159 17:44168438-44168460 CAGGACAGGCAGCGGGAGAAGGG + Intergenic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148245037 17:46024910-46024932 CAGGGCAGCCTGTGGGAGAAGGG + Exonic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150168117 17:62964557-62964579 CACGTTAGACAGATGAAGAAAGG + Intergenic
1150220846 17:63495221-63495243 CGGGGCACACAGAAGGAGAGGGG - Intronic
1150310224 17:64122225-64122247 CAGAGCAGACAGATGGGAAAAGG - Intronic
1150944623 17:69731650-69731672 CAGAGCAGAATGATAGAGAATGG + Intergenic
1151376355 17:73691497-73691519 CAGGGAAGACTGTAGGAGAAGGG - Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152307409 17:79529438-79529460 CACAGCAGACAGAGGGAGACTGG + Intergenic
1153917726 18:9760636-9760658 CCCGACAGACAGAGGGAGAAGGG - Intronic
1155396547 18:25392450-25392472 TAAGGCAGATAGATGGAAAATGG - Intergenic
1155552511 18:26980572-26980594 AAAGGCAGGCTGATGGAGAAGGG - Intronic
1155961794 18:32001458-32001480 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1156449414 18:37258641-37258663 CAGGACAGAGAGCTGGAGAGAGG + Intronic
1156768547 18:40689628-40689650 CAGGGCAGAAAGAGGAGGAAAGG - Intergenic
1157103079 18:44747473-44747495 CAGGCCACACAGCTCGAGAATGG + Intronic
1157453146 18:47802788-47802810 GAGGGAAGACAGTTGGAGAAAGG + Intergenic
1157491174 18:48124855-48124877 CAGAGCAGAGAGGTGGAGAGAGG - Intronic
1159019089 18:63128201-63128223 AAGAGCAGACGGATGGAAAAAGG - Exonic
1160444163 18:78914279-78914301 CAGGGAAGCCAGGTGGAAAATGG - Intergenic
1161673460 19:5627710-5627732 TAAGGCAGACAGATGGGGAAGGG - Intronic
1163041967 19:14609351-14609373 GAGGGAAGCTAGATGGAGAAGGG - Intronic
1163188108 19:15653793-15653815 CAGGACAGAAAGGAGGAGAAGGG + Intronic
1163216783 19:15885056-15885078 CAGGACAGAAAGGAGGAGAAGGG - Intronic
1165156452 19:33791825-33791847 CAGGGCAGGCCCAAGGAGAAGGG + Intergenic
1165362811 19:35347069-35347091 AGGGCCAGAGAGATGGAGAAGGG - Exonic
1165394440 19:35556697-35556719 CAGAGCTGAGACATGGAGAAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166762816 19:45235374-45235396 CAGGGCGGAAAAATGGAGGAGGG + Intronic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1166800124 19:45451376-45451398 CAGGGGAGACAGACAGACAAGGG + Intronic
1167110602 19:47458405-47458427 CGGGGGAGAGAGATGGGGAAAGG - Intronic
1168513381 19:56991305-56991327 AAGGTCAGACAGCTTGAGAACGG + Intergenic
1168576249 19:57513523-57513545 CTGGGCAAACAGATAGAAAAGGG + Intronic
1168663732 19:58186643-58186665 CAAGGCAGAAACAAGGAGAAGGG + Intronic
925144841 2:1574324-1574346 CAGGGCAGACAGGCGGTGAAGGG + Intergenic
925512226 2:4640887-4640909 CATGGCATGCAGATGGACAATGG - Intergenic
925673421 2:6335547-6335569 CACGGGAGAAAGATGGAGACTGG + Intergenic
925711962 2:6750007-6750029 GAGGACGGACAGATGGAGCATGG - Intergenic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926566147 2:14476615-14476637 GAGAGCAGACAGAGGAAGAAAGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
928898814 2:36295890-36295912 CAGGCCAGATAGATGGAAAGAGG + Intergenic
928903904 2:36351392-36351414 CAGAGAAGACAGATTCAGAAAGG + Intergenic
929617828 2:43326304-43326326 CTTGGCAGAGAGTTGGAGAATGG + Intronic
930020649 2:46999983-47000005 CAGGCCACACAGATTGTGAATGG - Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931196198 2:60054225-60054247 CACTGCAGAGAGAAGGAGAAAGG - Intergenic
932062601 2:68522736-68522758 CAGTTCAAACTGATGGAGAAAGG + Intronic
932144160 2:69304436-69304458 GAGGGCAGGCAGTTGGGGAAGGG + Intergenic
932274645 2:70442904-70442926 CAGCGCAGACATGGGGAGAATGG + Intergenic
932699122 2:73981503-73981525 TAGAGCAGACAGAGGGAGAGAGG - Intergenic
932800647 2:74739686-74739708 CAGGACAGACATTTGGGGAAGGG + Intergenic
933738115 2:85511669-85511691 CAGGGCTGGCAGGTTGAGAAAGG - Intergenic
933771281 2:85745848-85745870 CAGGGGAGGCAGATGCCGAAGGG + Intergenic
934085901 2:88509291-88509313 CAGGTCAGACAGGGAGAGAACGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934661767 2:96146794-96146816 CAGGGCAGACAAGTCCAGAAGGG - Intergenic
935214799 2:100967646-100967668 CAGGGCAGAAAGATGGACTACGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936543634 2:113372145-113372167 GAGGGAAGACAGCTGCAGAAAGG + Intergenic
938076854 2:128344339-128344361 CAGGTCACACAGCTAGAGAATGG - Intergenic
938164297 2:129012648-129012670 CAGGGCAGAGGGATAGAGAGTGG - Intergenic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938379427 2:130828276-130828298 CAGGCCAGGCAGTTGGGGAAGGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938732695 2:134158685-134158707 CAGGGCAGCCAGCGGGAGACGGG - Intronic
938921652 2:136000671-136000693 CATGGCAGAGGGAGGGAGAAGGG + Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
940037470 2:149325894-149325916 GAGGAAAGAGAGATGGAGAATGG + Intergenic
940892864 2:159051997-159052019 TAGGGCATACAGCTGGGGAATGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942361025 2:175171547-175171569 CAGCCCAGAGAGAGGGAGAATGG + Intergenic
945554543 2:211262671-211262693 GAGGGTAGAGACATGGAGAAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946064250 2:216973145-216973167 CAGGCCAGAGAGTGGGAGAAGGG + Intergenic
946105290 2:217363792-217363814 AAGGGCAGACAGATTATGAAGGG + Intronic
946248808 2:218401042-218401064 CAGGGCAAACAGATGGCCACTGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946484131 2:220084692-220084714 CAGGACAGGCACATAGAGAAAGG - Intergenic
947105896 2:226667624-226667646 AAGGCCAGAGAGATGGTGAAGGG + Intergenic
947468578 2:230378390-230378412 CTAGGCAGTCAGAAGGAGAAAGG + Intronic
947833897 2:233161691-233161713 AAGGGCAGACAGACTTAGAAAGG - Intronic
947839290 2:233197471-233197493 CAGGGCAGAGAGATGGTGGGGGG - Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948673574 2:239584100-239584122 GAGGGAAGTCAGTTGGAGAATGG + Exonic
948759825 2:240183672-240183694 CAGGGCAGAGAGGTGGGCAAGGG - Intergenic
948784937 2:240347447-240347469 CAGGGCAGACAGACGCCCAAAGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
949066020 2:241990681-241990703 CAGGGATGACAGATGGACAGAGG - Intergenic
1168845672 20:942904-942926 AAGGACAGACAGCTGGAAAATGG - Intergenic
1168849722 20:968152-968174 CAGGGCAGAAGGAGGGGGAAAGG + Intronic
1169749975 20:8981591-8981613 CAGGGCAGATATTTGCAGAAAGG + Intergenic
1170697354 20:18671118-18671140 CAAGGCAGGTGGATGGAGAAAGG + Intronic
1170808431 20:19654454-19654476 CAGAGCATACAGAGTGAGAAGGG - Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1172117432 20:32581319-32581341 CAGGGCAGAGAGAGGGCGAGGGG - Intronic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1173150972 20:40566174-40566196 CAGAGCTGGCAGATGGGGAATGG - Intergenic
1173537882 20:43829769-43829791 CAGGGCAGACATCAGGAAAAAGG - Intergenic
1173651817 20:44671181-44671203 AAGGGTAGAGATATGGAGAAGGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1175059670 20:56230508-56230530 CAGGGAAGAAAGAGGGAGAGAGG + Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175144560 20:56885863-56885885 GAGGTCAGACAGTTTGAGAAGGG - Intergenic
1175264681 20:57695478-57695500 CAGGGCAGACGGATTGTGAAAGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1176309710 21:5143037-5143059 CATGGCAGACAGCTGGGGGAGGG + Intronic
1176587390 21:8601326-8601348 CATGGGAGACAGATGTAGAATGG + Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178070343 21:28958430-28958452 CAGAGCAGACAAATGTAGGAAGG + Exonic
1178336722 21:31750046-31750068 CAGGGCAGGCAGATGGTTAGAGG - Intergenic
1178412953 21:32380879-32380901 CAGGATAGAAAGATGTAGAATGG - Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179012322 21:37565276-37565298 CAGGGCAGACAGATATGGCAGGG - Intergenic
1179128244 21:38611447-38611469 CAGGGCGGCCAGATGGAGAGAGG - Intronic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179534383 21:42041952-42041974 CAGGGCAGGCTGAAGGACAAAGG + Intergenic
1179847348 21:44118996-44119018 CATGGCAGACAGCTGGGGGAGGG - Intronic
1180270221 22:10578323-10578345 CATGGGAGACAGATGTAGAATGG + Intergenic
1180713426 22:17855525-17855547 CAGGGCGGACGGATGGAGGAAGG + Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182039813 22:27228823-27228845 CAGGGCAGCAAAATGAAGAAAGG + Intergenic
1182048972 22:27298872-27298894 GAGGGGAGAGAAATGGAGAATGG + Intergenic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182285524 22:29244826-29244848 CAGGGGAGACATCTGGAAAATGG + Intronic
1182288375 22:29260854-29260876 CCGGGCAGACAGATGCAGCTGGG - Exonic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182739977 22:32560640-32560662 CAGGTCAGAAAGATGGGGAAGGG + Intronic
1183623547 22:38988348-38988370 CAGTGAAGACAGTTGGAGAGGGG + Intronic
1183714313 22:39524756-39524778 CTTGGCAGACAGATGGAGAGAGG - Intergenic
1184201844 22:42974924-42974946 CAAGGCAGCCAGCTGGAGCAAGG + Intronic
1184244585 22:43229428-43229450 CAGGGCAGAAACATTGTGAATGG + Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1184428017 22:44424449-44424471 CAGAGCAGAAAGATGGAGAGAGG - Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
949140029 3:620731-620753 CATGGCAGACAGATGTAGAATGG - Intergenic
949406342 3:3718644-3718666 CAGCACAGCCAGCTGGAGAATGG + Intronic
949483648 3:4517251-4517273 AAAGGCAGACAGAGGCAGAATGG + Intronic
950313955 3:11984000-11984022 CATAGCAGAGAGATGGAGAAAGG + Intergenic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
951098150 3:18655492-18655514 CAGGGCAGAAAGTTGGTAAAAGG - Intergenic
951739606 3:25905914-25905936 CTGGGCAGTCTGATGGAGAATGG + Intergenic
952171153 3:30808168-30808190 CAGGGCAGAGAGGTGGAAAAAGG + Intronic
952341454 3:32451043-32451065 CAGTGCAGACAGTTGGGGACCGG + Intronic
952521204 3:34159421-34159443 CAGGGGTGACACATGGAGAGAGG - Intergenic
952597008 3:35029686-35029708 CAGGCCAGAGAGAAGGAGATGGG - Intergenic
954222599 3:49163695-49163717 CAGGGTAGACACCTGGATAAAGG + Exonic
954335185 3:49912132-49912154 CATGGCAGACAGTGGCAGAAGGG - Intronic
954366787 3:50150696-50150718 CAGTGCAGAAGGATGAAGAAGGG + Intergenic
954373927 3:50184446-50184468 CAGGGCAGAAACTTGGAGAGCGG + Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
955397722 3:58569070-58569092 CAGGGCAGAAGGATGGACTAAGG - Intronic
955497024 3:59544106-59544128 CAGGGAAGACAGGTATAGAAAGG + Intergenic
955543988 3:60007900-60007922 GAGGGTAGACAAATGGAAAAAGG + Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956251493 3:67239003-67239025 CAGTACAGAAGGATGGAGAATGG - Intergenic
956289690 3:67648402-67648424 AAGGGCAAAAAGATGGGGAAAGG + Intronic
957571530 3:81952757-81952779 CAGGGCAGACAGATTTTAAATGG + Intergenic
958421798 3:93938954-93938976 GAGGGTAGAGACATGGAGAAGGG - Intronic
959964446 3:112337191-112337213 CATGGCAGACAAAGGGAGATGGG + Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
960557661 3:119046729-119046751 AAGGGCAGCCAGAGAGAGAAAGG + Intronic
961356463 3:126343039-126343061 CAGGGCAGACAGAGCCAGAAGGG - Exonic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
962467315 3:135672882-135672904 CCTGGCAGACAGATCCAGAAAGG - Intergenic
962524185 3:136222779-136222801 AAGGGTAGAGACATGGAGAAGGG + Intergenic
963319577 3:143798456-143798478 AAGGGTAGAGACATGGAGAAGGG - Intronic
963520286 3:146354753-146354775 GAGGGTAGAGACATGGAGAAGGG - Intergenic
963973644 3:151457006-151457028 CAGGTGAGACTGATGGAGAGAGG - Exonic
964026045 3:152076274-152076296 CAAGGCAGGCATAGGGAGAATGG + Intergenic
964655979 3:159066590-159066612 CAGGGCAGTCAGGTGGAGTGGGG + Intronic
964766163 3:160179824-160179846 AAGGGCAGAAAGAGGGAGAGGGG + Intergenic
964973902 3:162597217-162597239 CAGGGCAGAAAGTAGGAGATGGG - Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966916613 3:184587770-184587792 CTTGGCAGAGAGAAGGAGAAAGG + Intronic
966940240 3:184741484-184741506 AAGGGCTGTCAGATGGATAAAGG - Intergenic
967326084 3:188241239-188241261 CAGGGCAAACAGCTGCAGAGAGG - Intronic
967961367 3:194927926-194927948 GAGGGCAGTGAGATGGAGGAGGG - Intergenic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
968610362 4:1554226-1554248 CAGGTCAGACAGAGGGTGAGGGG - Intergenic
968653697 4:1769831-1769853 CAGGGAAGTCAGGTGGAGTAAGG + Intergenic
968813341 4:2809784-2809806 CAGGGCAGGCAGAGGGCCAAGGG - Intronic
969388702 4:6874613-6874635 CAGTACAGACAGGTGGTGAAAGG + Intronic
969484844 4:7466555-7466577 CACTGCAGCCAGAGGGAGAATGG - Intronic
969500685 4:7550857-7550879 CGGGTGAGACAGATGGAAAAAGG - Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971030279 4:22629339-22629361 AAAGGCAGGCTGATGGAGAAGGG - Intergenic
971328871 4:25665886-25665908 CAGGGCAGAGAGACAGAGACAGG + Intronic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
973745798 4:53962356-53962378 AAGGGGAGAAGGATGGAGAAAGG + Intronic
973757048 4:54085518-54085540 CAGAGCAGTCAGATGAGGAAGGG + Intronic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
975635823 4:76446922-76446944 CAGAGCAGACAGATTGAGCGTGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977523191 4:98111595-98111617 CAGGCCAGGCAGATGTAGAAGGG - Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
978237079 4:106472565-106472587 GAGGGCAGAGAGGTGGAGATAGG - Intergenic
978303390 4:107294964-107294986 GAGGGTAGAGACATGGAGAAGGG + Intergenic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981886140 4:149675311-149675333 TAGGGAAGACAAAGGGAGAATGG + Intergenic
982149367 4:152435493-152435515 CAGTGTAGAAAGATTGAGAAAGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985576606 5:676107-676129 CAAGGCAGTCAGCTGGAGAGAGG + Intronic
985802332 5:2012940-2012962 CAGGGCTGAGAGTGGGAGAAAGG + Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
986156567 5:5182492-5182514 CATGGCAGATGGATGGATAATGG + Intronic
986353882 5:6905464-6905486 CACTGGAGACAGGTGGAGAATGG - Intergenic
987574512 5:19707909-19707931 CATGGCATGCAGATGGAGAAGGG - Intronic
988841342 5:35086844-35086866 GATGGCAGAAAGATGGAGATTGG - Intronic
989162223 5:38402320-38402342 CAAGGCAGACAGATGGGGAATGG - Intronic
989975156 5:50576863-50576885 CAGGGAGGACAGATGGATAAAGG + Intergenic
990291751 5:54359371-54359393 CAGGGCAGACAGATGGGTACAGG - Intergenic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
991389396 5:66125993-66126015 AAGAGGAGACAGCTGGAGAAGGG + Intergenic
991507674 5:67342433-67342455 CAGGGTAGCCACATAGAGAAGGG + Intergenic
991507832 5:67343299-67343321 CAGGGCAGCCACATACAGAAGGG - Intergenic
992288596 5:75261619-75261641 GAGGACAGAAAGATGGAGAGAGG + Intergenic
992323384 5:75636473-75636495 CAAGGCAGACAGACGATGAAAGG + Intronic
992874849 5:81043815-81043837 AGGAACAGACAGATGGAGAAGGG - Intronic
995229240 5:109739921-109739943 GAGGGCTGACAGATGGAGGGAGG + Intronic
996949725 5:129110965-129110987 CAGGGCAGGCAGCTGGTGATGGG + Intronic
997202010 5:132016201-132016223 CATGCCTGACAGATGGACAATGG - Intergenic
997657278 5:135564635-135564657 ATGGGCAGACACATGGAGAGAGG + Intergenic
997796564 5:136816805-136816827 CAGGGGAGGCAGATGTGGAAGGG - Intergenic
998869578 5:146538651-146538673 CAGGGCAGACATAGAAAGAAGGG + Intergenic
999151173 5:149427204-149427226 CAGGGCAGGAAGAGTGAGAAGGG + Intergenic
999302518 5:150500040-150500062 CGGGACAGACAGTTGGACAAGGG - Intronic
999499072 5:152128721-152128743 CAGGGAGGAAAAATGGAGAAGGG - Intergenic
1000089242 5:157915838-157915860 CAGGCCAGGCTGCTGGAGAATGG + Intergenic
1001321514 5:170686320-170686342 CAGGGCAGAAAGAGGGAAAGAGG + Intronic
1001585669 5:172832559-172832581 CCTGGCAGCCAGATGGAGAAAGG + Intergenic
1001847753 5:174936833-174936855 CAGAGCTGTCAGATGGAGACTGG + Intergenic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1002594084 5:180311105-180311127 CAGAGCAGGCAGTTGGGGAAGGG - Intronic
1002917171 6:1538659-1538681 AGGGGAAGAAAGATGGAGAAGGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005099307 6:22152827-22152849 CCTGGCACACAGATGAAGAATGG - Intergenic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1007625689 6:43245060-43245082 CATGGTGGACATATGGAGAAGGG - Intronic
1007654589 6:43444668-43444690 CAGGCCAGGCGGATGGAGATGGG + Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008025403 6:46630256-46630278 AATGGCACACAGAAGGAGAATGG + Intronic
1008033516 6:46722466-46722488 TAGGGCAGTCAGAGAGAGAAGGG + Intronic
1008060072 6:46987752-46987774 GGGGGAAGACAGATGAAGAAAGG - Intergenic
1008399072 6:51042896-51042918 CAAGGCAGAGGGGTGGAGAAGGG - Intergenic
1008441962 6:51541982-51542004 TACGGCAGACACAAGGAGAATGG - Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1011121476 6:83958479-83958501 CAGTCAAGAGAGATGGAGAAGGG + Intronic
1011186922 6:84687761-84687783 CAAGGCAGACAGGGGAAGAAGGG + Intronic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1012677281 6:102132553-102132575 CAGGACAGAGACATGGAGAAAGG + Intergenic
1013799462 6:113925002-113925024 CAGGGGAGATACATTGAGAAGGG + Intergenic
1014115502 6:117664223-117664245 AAGGGTAGAGACATGGAGAAGGG + Intergenic
1014554715 6:122831635-122831657 CAGGGTAGAAAGGTGGAAAAAGG - Intergenic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1016430858 6:143983776-143983798 GTGGGAGGACAGATGGAGAATGG + Intronic
1016704692 6:147093114-147093136 CATAGCAGAGAGATGGACAAAGG - Intergenic
1016850816 6:148617101-148617123 CAGGGGAGGGGGATGGAGAAAGG - Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018757966 6:166865908-166865930 AAGGAAAGACGGATGGAGAAGGG + Intronic
1018801162 6:167223324-167223346 CAGGGCTCACAGATGGTAAAAGG - Intergenic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1019936000 7:4258363-4258385 CAGGGCAGAGAGATGCCCAAAGG + Intronic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1023139943 7:37091817-37091839 CAGGCAAGACAGAATGAGAACGG + Intronic
1023795440 7:43788274-43788296 CAAGGCTGACAGTTAGAGAAGGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024571404 7:50725609-50725631 CTGGGCAGATAGATGGCAAAGGG + Intronic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026575134 7:71565482-71565504 GAGGGATGAAAGATGGAGAAGGG - Intronic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1026796112 7:73367076-73367098 CAGGGCTGGCAGGTGGAGAGGGG - Intergenic
1026984169 7:74544666-74544688 CAGGCCAGATAGCTGGGGAATGG - Intronic
1027158071 7:75782465-75782487 AAGGGTAGAGACATGGAGAAGGG - Intronic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1027309270 7:76937238-76937260 AAGGGCATACAGAGGGAGACTGG - Intergenic
1029453892 7:100657459-100657481 GAAGAGAGACAGATGGAGAAAGG - Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030407357 7:109130874-109130896 CAAGGCAGACAGATTTTGAAGGG + Intergenic
1031452136 7:121935394-121935416 CAGCTCAGACAGAAGAAGAAGGG - Intronic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1032544760 7:132732412-132732434 CAAAGCAGCCAGAGGGAGAACGG + Intergenic
1032784177 7:135187441-135187463 CAGGCCAGAGAGAAAGAGAAGGG - Intronic
1032960178 7:137023991-137024013 CAGGGCAGAAAGATGTAGACTGG + Intergenic
1033625422 7:143106014-143106036 AAAGGTAGAGAGATGGAGAAGGG - Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034149570 7:148903677-148903699 CAAGGCAGAAAGAAGGGGAAGGG + Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034696136 7:153055629-153055651 AAGTGCAGATAAATGGAGAAGGG - Intergenic
1035077838 7:156192721-156192743 CAGGGCAGACCTACTGAGAACGG + Intergenic
1035318814 7:158014890-158014912 GAGGAAAGACAGATGGAGATAGG - Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036553017 8:9831818-9831840 CAGGCCAGACATATGCAAAACGG - Intergenic
1037463525 8:19136818-19136840 AAGGCCACACAGCTGGAGAAGGG - Intergenic
1039600925 8:38836519-38836541 CAGGGCTGAAAGATAAAGAAGGG - Intronic
1040918544 8:52589810-52589832 GAGAGAAGAGAGATGGAGAAGGG - Intergenic
1041237669 8:55820831-55820853 AAGGACAGAGAGAGGGAGAACGG - Intronic
1041442280 8:57910153-57910175 AAGGACTGACAGATGAAGAATGG - Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1041917694 8:63152841-63152863 AAGGGTAGAGACATGGAGAAGGG + Intergenic
1042263339 8:66883052-66883074 CAGCCCAGAAAGAAGGAGAATGG + Intronic
1043398123 8:79858141-79858163 CTGGGAAGCCAGGTGGAGAATGG - Intergenic
1043708935 8:83389700-83389722 AAGAACAGAGAGATGGAGAATGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1045508290 8:102794267-102794289 CTGCGCAGGCAGATGGAGAGAGG - Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1047160940 8:122378480-122378502 TAGGGCAGCCAGATGGCAAAGGG + Intergenic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1048295296 8:133209553-133209575 CAGGGCACACAGCTGGTGAGGGG - Intronic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1050213092 9:3287048-3287070 AAGGGGAGGCACATGGAGAATGG - Intronic
1051708176 9:19902340-19902362 CAAGGCAGGCAAATGGAAAAAGG + Intergenic
1052560740 9:30079682-30079704 AGGGGCAGGCAAATGGAGAATGG - Intergenic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1054738742 9:68782991-68783013 CAGGGGCAACAGATAGAGAAGGG - Exonic
1056621442 9:88217956-88217978 CAAGGCGGACAGATGGAGCCTGG + Intergenic
1056775825 9:89511974-89511996 CATGGCAGAGAGATGGAAGAGGG - Intergenic
1057076159 9:92139171-92139193 CAGGGAAGGCATATGGAGAAAGG + Intergenic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058741275 9:107944999-107945021 TATGGCAGAGGGATGGAGAAAGG + Intergenic
1059282043 9:113143269-113143291 TAGGGCACACAGCTGGTGAAGGG - Intergenic
1059645802 9:116265794-116265816 CTGGGCAGACAAAGAGAGAATGG - Intronic
1059663066 9:116420477-116420499 CAGGGCCCACAGAGGGTGAACGG + Intergenic
1059764936 9:117375146-117375168 AAGGACAGAGAGATGGACAAGGG + Intronic
1060816809 9:126639342-126639364 CAGGCCAGACAGATGATGGAGGG - Intronic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061251359 9:129428341-129428363 CCTTGCAGACTGATGGAGAAAGG + Intergenic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1062508631 9:136892017-136892039 TAGGGTAGACAGATTCAGAATGG - Intronic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203562058 Un_KI270744v1:65511-65533 CAGGTCAGATAGGTGGAGGAGGG - Intergenic
1203617349 Un_KI270749v1:79508-79530 CATGGGAGACAGATGTAGAATGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186428669 X:9485753-9485775 CAGGGCAGGGGGATGAAGAAAGG - Intronic
1186556018 X:10559660-10559682 CAGTCCTGAGAGATGGAGAAAGG - Intronic
1186898762 X:14031525-14031547 CAGGAAAGAAAGATGGAGAGGGG + Intergenic
1187103928 X:16221336-16221358 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1187235700 X:17465017-17465039 CTGGGAAGAAAGATGTAGAACGG + Intronic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1188819749 X:34760508-34760530 CATGTAAGACAGAGGGAGAAAGG - Intergenic
1189133019 X:38519876-38519898 CAGGGCAGGCAGTTAGGGAAGGG + Intronic
1189368451 X:40408354-40408376 CTGGGCAGAGAGATGTAGAGAGG + Intergenic
1189760322 X:44315523-44315545 CAAGGCAGAGAGAGGGAGACTGG + Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193195971 X:78631840-78631862 CAGGGCACACTGATGCAAAAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1195017115 X:100790959-100790981 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1195247077 X:103004558-103004580 CCCAGCAGACAGATGGAGCATGG + Intergenic
1195410718 X:104566064-104566086 GAGGGGAGGCAGATTGAGAAAGG - Intergenic
1195766963 X:108306331-108306353 AAGTGCAGGCAGCTGGAGAAAGG + Intronic
1195958623 X:110361681-110361703 CATGGAAGGCAGATAGAGAATGG - Intronic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1197850364 X:130852508-130852530 CAGGGCAAACATATCCAGAATGG + Intronic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1198144541 X:133841872-133841894 CAGGGGAGAAAGATGTAGACTGG - Intronic
1198145121 X:133848390-133848412 TAGAGCACACAGATAGAGAAGGG + Intronic
1198276532 X:135099212-135099234 CAGGGGAGACCGTGGGAGAAGGG - Intergenic
1198309966 X:135421540-135421562 CAGGGGAGACCGTGGGAGAAGGG + Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200091143 X:153636636-153636658 CAGGGCAGCCAGCTTGAGACTGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic