ID: 1173941377

View in Genome Browser
Species Human (GRCh38)
Location 20:46913987-46914009
Sequence CAGAGTGGTAAAGGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173941377_1173941384 -1 Left 1173941377 20:46913987-46914009 CCTCCCACCCCTTTACCACTCTG 0: 1
1: 0
2: 2
3: 42
4: 465
Right 1173941384 20:46914009-46914031 GCTGTCCTACTGTGTTTTCTTGG 0: 1
1: 0
2: 0
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173941377 Original CRISPR CAGAGTGGTAAAGGGGTGGG AGG (reversed) Intronic
900565369 1:3329365-3329387 CACAGTCGGGAAGGGGTGGGGGG - Intronic
900695807 1:4009701-4009723 CAGAGAGGTGAACAGGTGGGTGG - Intergenic
900882296 1:5390893-5390915 CTGACTGGTACTGGGGTGGGAGG + Intergenic
901206347 1:7498062-7498084 GAGAGTGGGGAAGGGGTGCGGGG + Intronic
901752851 1:11422127-11422149 CAGCATGGCAGAGGGGTGGGAGG - Intergenic
902638779 1:17752815-17752837 CAGAGTGATCATGAGGTGGGAGG + Intergenic
902793481 1:18784831-18784853 CAGAGCAGGATAGGGGTGGGGGG - Intergenic
902877816 1:19351485-19351507 GGGAGGGGTGAAGGGGTGGGGGG + Intronic
902924120 1:19684494-19684516 CAGAGGGGTAGAGGGGTAGAGGG - Intronic
903257499 1:22112714-22112736 CAGCCAGGGAAAGGGGTGGGGGG + Intergenic
903438690 1:23371071-23371093 CACTGGGGCAAAGGGGTGGGGGG - Exonic
904199691 1:28811951-28811973 CAAAGTGGCAAGGGGGTGGGAGG + Intergenic
904420631 1:30388904-30388926 AAGAGTGGGAAGGGGGTAGGAGG - Intergenic
904854672 1:33488874-33488896 CAGGCTGGGACAGGGGTGGGTGG + Intronic
904978893 1:34480003-34480025 CAGAGGGGAGAAGGGGTTGGGGG + Intergenic
904995411 1:34627702-34627724 CAGAGTGGGGAAGGGGAGGTAGG + Intergenic
905265781 1:36753561-36753583 CAGAGTGATAAAGGGGCTGTGGG + Intergenic
905694819 1:39966685-39966707 CAGAGAGGTAAGGGGGTGCCTGG + Exonic
906945312 1:50289864-50289886 CAGGGTGATACAGAGGTGGGGGG - Intergenic
909774492 1:79467057-79467079 CAGAATCTTAAAGAGGTGGGTGG + Intergenic
910002947 1:82359565-82359587 GAAAGTGGAGAAGGGGTGGGAGG + Intergenic
910002958 1:82359602-82359624 GAAAGTGGAAAAGGAGTGGGAGG + Intergenic
911162353 1:94693963-94693985 CAGAGTCCTAAAGGAGTTGGAGG + Intergenic
912738659 1:112173674-112173696 CAGAGTGGGAAAGGGGGTGAGGG - Intergenic
914899269 1:151703284-151703306 CAGAGAGGCAGGGGGGTGGGAGG + Exonic
915004648 1:152624444-152624466 CAGAGGGGTAGAGTGGAGGGAGG + Intergenic
916206011 1:162317008-162317030 CATAATGATAAGGGGGTGGGTGG + Intronic
916318220 1:163473933-163473955 TAGAGTTGGTAAGGGGTGGGAGG + Intergenic
916328690 1:163592181-163592203 GAAAGTGGAGAAGGGGTGGGAGG - Intergenic
916421833 1:164645074-164645096 CAGAGACATAAAGGAGTGGGAGG + Intronic
916472181 1:165135124-165135146 TAGAGTCGCAAAGGTGTGGGAGG - Intergenic
916521741 1:165569607-165569629 CAGTGAGGTAAAGAGGTGGTGGG - Intergenic
916574147 1:166052206-166052228 CCGAGTGGGAAAGGGATGTGAGG + Intergenic
917816204 1:178712737-178712759 AAGAGAGGGAAAGGGGAGGGGGG + Intergenic
917995808 1:180437302-180437324 GTGACTGGTCAAGGGGTGGGAGG + Intronic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919753684 1:201053631-201053653 CAGAGGGGTAAGGGGCAGGGCGG + Intronic
920000109 1:202791619-202791641 CCGAGTGGTTAAAGGTTGGGGGG - Intronic
920403466 1:205692079-205692101 CAGAGGGGGAAAGGTGTGGAGGG - Intergenic
920966427 1:210705134-210705156 GGGAGTGGTAGAGGGGAGGGAGG - Intronic
922358514 1:224799116-224799138 CACAGTGCTAAAGGGGTGTATGG + Intergenic
922428532 1:225522993-225523015 AAGAGTAGGAAACGGGTGGGAGG - Intronic
924108109 1:240669703-240669725 CAGAAGGGTGAAGGGGTGGAAGG - Intergenic
924421319 1:243912655-243912677 GAAAGGGGTAAAGAGGTGGGAGG + Intergenic
924515454 1:244761699-244761721 CAGACTGGCAAAGGGGTCCGTGG - Intergenic
924953353 1:248906017-248906039 CAAAGTAGGACAGGGGTGGGAGG + Intergenic
1062872904 10:922071-922093 CGGAGGGGTCAGGGGGTGGGGGG + Intronic
1064288425 10:14012483-14012505 CAGGGTGTGAAAGGGGTGGCGGG + Intronic
1064954613 10:20894034-20894056 CAGAGTGGTACAGATGTGGACGG - Intronic
1066167814 10:32807628-32807650 CAGTGTGGGAAAAGGGTGAGAGG + Intronic
1066281504 10:33922573-33922595 CACAGTGGTGAAGGGGAGGTGGG + Intergenic
1069353571 10:67558355-67558377 CTGAGAGAAAAAGGGGTGGGTGG - Intronic
1070026767 10:72639358-72639380 CAGAGAGGTACAGGGTAGGGGGG - Intergenic
1070290256 10:75109166-75109188 CACAGAGGCAGAGGGGTGGGCGG - Exonic
1070538458 10:77397765-77397787 CAGAATGGTGGAAGGGTGGGAGG - Intronic
1070598591 10:77849731-77849753 GAGAGGGGGACAGGGGTGGGAGG + Intronic
1070734953 10:78856889-78856911 CAGGGTGGAAAAGGGGTAGTGGG + Intergenic
1070756366 10:78995897-78995919 CATAGTGGCCAAGGAGTGGGAGG - Intergenic
1070784132 10:79153370-79153392 CAGAGATGTCAAGGGATGGGAGG + Intronic
1071555825 10:86600638-86600660 CAGAGTGGAAAAGGTGTGATTGG + Intergenic
1072132803 10:92512960-92512982 CACATTTGTAAAGTGGTGGGTGG - Intronic
1072861574 10:99011003-99011025 CAGAGGGGTTGAAGGGTGGGAGG - Intronic
1073062170 10:100739515-100739537 CAGAGTTGGAGAGGGGCGGGAGG - Intronic
1073062903 10:100742895-100742917 CAGTCTAGTAGAGGGGTGGGGGG - Intronic
1073081925 10:100865802-100865824 CAGAGGAGTACAGAGGTGGGAGG + Intergenic
1073191153 10:101651327-101651349 GAGGGTGGGAAATGGGTGGGGGG + Intronic
1073451153 10:103610141-103610163 CAGAGTGAGTGAGGGGTGGGAGG + Intronic
1073487212 10:103827121-103827143 CAGGGTGGATGAGGGGTGGGAGG + Intronic
1073614618 10:104981021-104981043 CAAAGCTGCAAAGGGGTGGGGGG + Intronic
1075228115 10:120648016-120648038 AAGAGTGGAACAGTGGTGGGAGG + Intergenic
1075685733 10:124364122-124364144 CAAAGGGGTAGAGGGGTGGGTGG - Intergenic
1076099561 10:127764875-127764897 CACAGTTGGCAAGGGGTGGGAGG - Intergenic
1076261300 10:129069127-129069149 CAGAGTGGTGTAGGGGTAGGGGG + Intergenic
1076359454 10:129876896-129876918 CAGAGGGGTAGCTGGGTGGGGGG - Intronic
1077061864 11:621064-621086 CATACTGGTAATGGGGAGGGAGG - Exonic
1078413469 11:11146843-11146865 CAGAGTGGTAGACGAGTGGCAGG - Intergenic
1078950015 11:16120110-16120132 GAGAGAGAGAAAGGGGTGGGGGG - Intronic
1080689613 11:34545433-34545455 CAGAGTGGGCAAGGCCTGGGAGG - Intergenic
1080857177 11:36122295-36122317 CAGAGTGGTCAAGGATTTGGAGG + Intronic
1081473889 11:43405303-43405325 CAGACTGGTTCAGGGTTGGGCGG - Intronic
1081831753 11:46120834-46120856 CAGAGGGGGAAGGGGGAGGGAGG + Intronic
1081969360 11:47187101-47187123 CAGACTGATAAAGGGGGTGGAGG - Intergenic
1084724914 11:70935231-70935253 CTGAGTGACAAATGGGTGGGTGG - Intronic
1084957900 11:72701230-72701252 CAGAGAGGTAATGGGGGTGGTGG + Intronic
1084970547 11:72769080-72769102 AAAAGGGGTAAAGGGCTGGGGGG + Intronic
1085439949 11:76551243-76551265 GAAAGGGGTAAGGGGGTGGGAGG + Exonic
1086458316 11:86981264-86981286 CAAAGTGGAATAGGGGTGGGAGG - Intergenic
1088335611 11:108700179-108700201 TTGTGTGGTACAGGGGTGGGAGG - Intronic
1088432045 11:109769229-109769251 CAGAGTGATACAGGGGTTGGAGG + Intergenic
1089293226 11:117450840-117450862 CAGCATGGTAAACAGGTGGGAGG + Intronic
1089690574 11:120184542-120184564 CAGAGGAGGAAAGGGGAGGGAGG - Intronic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1091644509 12:2263608-2263630 CAGAGTGATAAAGGTGGAGGTGG + Intronic
1091713447 12:2759608-2759630 CAGAGGGGAGAAGGGGTGTGGGG - Intergenic
1091916858 12:4275975-4275997 GGGAGTGGGAAAGGGTTGGGGGG - Intronic
1092530297 12:9338534-9338556 CAGAATGGAAAAGGGGAGGAAGG + Intergenic
1092705896 12:11284207-11284229 AAGAGTGGGAAAGGGGAGAGGGG - Intergenic
1092900434 12:13054725-13054747 CAGTGAGGCCAAGGGGTGGGTGG + Intronic
1092906373 12:13103625-13103647 CAGAGGGGTAAGGTGGTGTGTGG + Exonic
1093460870 12:19405675-19405697 CAGGATGGTAGAGAGGTGGGAGG + Intronic
1093705504 12:22270649-22270671 CAGAAAGGTAAAGGGGTGAAAGG + Intronic
1094698550 12:32845774-32845796 CAAAGTGGTCAAAGAGTGGGAGG + Intronic
1095451587 12:42337195-42337217 CAGAGTGGCAGAGGGGAGAGGGG - Intronic
1096968827 12:55649148-55649170 CAGAGAGGGAGAGGGGTGAGGGG + Intergenic
1097693967 12:62759745-62759767 GAAAGTGGAAAAGGAGTGGGAGG - Intronic
1097693978 12:62759782-62759804 GAAAGTGGAAATGGGGTGGGAGG - Intronic
1098382800 12:69886612-69886634 CAGCGTTGTCAAAGGGTGGGGGG - Intronic
1098918152 12:76278334-76278356 AAGAGGGGTACAGGGATGGGAGG - Intergenic
1099413347 12:82358810-82358832 CAGAGTGGGAAGCAGGTGGGTGG + Exonic
1099922540 12:88977442-88977464 CAGAGAGGAAAGGGGGAGGGTGG - Intergenic
1101005512 12:100397605-100397627 CACAGTGGTAAATGTGTCGGGGG + Intronic
1101709174 12:107248980-107249002 AAGAGTGGTAAAGGCTTGGAGGG - Intergenic
1102630191 12:114271345-114271367 CAGATAGTTAAAGGGGCGGGGGG + Intergenic
1102875268 12:116444102-116444124 CAGAGTGGGTATGGGTTGGGGGG + Intergenic
1103599442 12:122044910-122044932 TAAAGTAGGAAAGGGGTGGGGGG + Intronic
1103719025 12:122963703-122963725 CAGAGGGGGAATGGAGTGGGGGG + Intronic
1103768398 12:123299996-123300018 GAGAGATGGAAAGGGGTGGGAGG + Intronic
1104002420 12:124868707-124868729 CAGAGTGGGCAAGGAGAGGGAGG - Intronic
1104365165 12:128170313-128170335 AAGAATTGCAAAGGGGTGGGCGG + Intergenic
1104664196 12:130635820-130635842 TAGAGTGGGGAAGGGTTGGGAGG - Intronic
1104774655 12:131384213-131384235 CACAGTGGTATAGGAGAGGGCGG - Intergenic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1107236658 13:38178663-38178685 GAGAGAGGGAAAGGGGTGTGTGG + Intergenic
1107392624 13:39982904-39982926 CAGAGTGGAGAAGGTGTGGCCGG + Intergenic
1108992017 13:56671467-56671489 CAGATTGATAAAGGGGAGGGAGG - Intergenic
1109065029 13:57675909-57675931 CAGAGTAGTGAAGAGGTAGGAGG + Intronic
1110025559 13:70534302-70534324 CAGAGTCTGAATGGGGTGGGAGG - Intergenic
1110059579 13:71024733-71024755 CAGAAAGGTGAAAGGGTGGGAGG - Intergenic
1111541439 13:89672284-89672306 CAGAGTGGGAGTGGGGTGGATGG - Intergenic
1112559605 13:100501362-100501384 CAGAAGGGTGACGGGGTGGGAGG - Intronic
1114353996 14:21887331-21887353 CAGAATGGTATAGGGATGTGTGG + Intergenic
1115360748 14:32498748-32498770 CAGAGGGGTAAGTGGGCGGGAGG + Intronic
1115995010 14:39187139-39187161 CAGAGTGAAATAGGGGTGAGTGG + Intergenic
1117347577 14:54848689-54848711 CTGAGTGGTAAACGGGGTGGCGG - Intronic
1117961649 14:61169282-61169304 CAGTCTGGTACAGAGGTGGGGGG + Intergenic
1118785073 14:69038873-69038895 CACAGTGGGAAAGGGGTGGATGG - Intergenic
1119762109 14:77158914-77158936 CAGGGTGGTGAAGGTGAGGGTGG - Intronic
1120024997 14:79573331-79573353 CAGAATGGTAGAGAGGTGGGAGG + Intronic
1120574832 14:86169227-86169249 TAAAGTGGTAAAGGGCAGGGAGG - Intergenic
1120880502 14:89412173-89412195 CAGAGTGGGCAGGGGATGGGGGG + Exonic
1121588209 14:95078627-95078649 CAGTGTGGCAGCGGGGTGGGGGG - Intergenic
1122381510 14:101310236-101310258 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1123931172 15:25172380-25172402 CATAGTGGGAAGGTGGTGGGTGG - Intergenic
1124145791 15:27124038-27124060 CAGATTGGTAGAGGGGTGTTTGG + Intronic
1124350097 15:28948933-28948955 CAGAGTTGTAAAGCGGGGGGTGG + Intronic
1124839748 15:33230570-33230592 CAGTGCAGTGAAGGGGTGGGGGG - Intergenic
1127309158 15:57737230-57737252 AAGAGTGAGAAAGGGGTGCGGGG - Intronic
1127338979 15:58021435-58021457 CAAAGTGGGAAATGGGTGAGTGG + Intronic
1128566618 15:68704951-68704973 CAGAGTGGATAAGGCATGGGAGG - Intronic
1129901879 15:79157657-79157679 CAGTGGGGTGGAGGGGTGGGGGG + Intergenic
1130262636 15:82369904-82369926 CAGAGTGGGGAAGGAGAGGGAGG - Intergenic
1130278591 15:82499043-82499065 CAGAGTGGGGAAGGAGAGGGAGG + Intergenic
1131572093 15:93548789-93548811 CAGAAGGGTACAGGGGTGGCAGG + Intergenic
1131749147 15:95487254-95487276 TAGAGTTGTAAAGGGCTTGGTGG + Intergenic
1132967975 16:2670105-2670127 CAGACCGGGAAAGGGGCGGGGGG - Intergenic
1133805561 16:9123889-9123911 CAGATTGTTAACTGGGTGGGTGG + Intergenic
1133939256 16:10294773-10294795 AATAGTGGTAAAGTGTTGGGTGG - Intergenic
1134052526 16:11146682-11146704 CAGATGGGTAAATGGGTAGGTGG + Intronic
1135038236 16:19096332-19096354 CAGAGCGAGAAAGGAGTGGGAGG - Intergenic
1135118833 16:19747635-19747657 CGGAAGGGTGAAGGGGTGGGAGG - Intronic
1135135719 16:19884514-19884536 CAGAGCCGTAGAGGGGTGGGCGG - Intronic
1135904170 16:26495509-26495531 CAGAAGGGTGAAGGGATGGGAGG + Intergenic
1136403867 16:30032101-30032123 CAGAGTGGGAAAGGACTGCGGGG + Intronic
1137246657 16:46711464-46711486 CGAAGGGGTAAGGGGGTGGGGGG - Intronic
1138360882 16:56425849-56425871 CAGAGGGTTAATGGGGTGGGGGG - Intergenic
1138487098 16:57352784-57352806 GAGAGGGGTAATGGGGAGGGCGG + Intergenic
1139308195 16:66005952-66005974 CAGAGTGGGTAAGGGGAGGCTGG + Intergenic
1139596191 16:67959720-67959742 CAGTGTGGGAAAGGGCAGGGTGG + Intronic
1142161893 16:88562019-88562041 AAGGGTGATAGAGGGGTGGGGGG - Intergenic
1142284949 16:89167875-89167897 CAGAGGGGTCAGGGGGTGGCGGG - Intergenic
1142637086 17:1264419-1264441 CAGTTTGGTACTGGGGTGGGAGG + Intergenic
1143736683 17:8916220-8916242 GAGCGTGTCAAAGGGGTGGGTGG - Intronic
1143891714 17:10107398-10107420 CAGAGTGGTCCAGTGGTGGCAGG + Intronic
1144581486 17:16461844-16461866 CAGAGGGGTAGTGGGGTAGGGGG - Intronic
1145877429 17:28330336-28330358 TAGAGGGGTAGAGGGCTGGGTGG - Intronic
1145938308 17:28727536-28727558 CAGAGTGGGCAAGGGGTGTGAGG - Intronic
1146948999 17:36892801-36892823 CAGGGTGGGGCAGGGGTGGGAGG - Intergenic
1147387421 17:40090600-40090622 CAGAGTGCTAAAGGGGTGGAGGG - Intronic
1147473979 17:40692220-40692242 CAGAATGTTAAAGAGTTGGGTGG - Intergenic
1148134592 17:45284101-45284123 CAGTGAGATGAAGGGGTGGGAGG + Intronic
1148457767 17:47820177-47820199 GAGAGTGGGAAAGCGGTGGTGGG - Intronic
1148458264 17:47822433-47822455 CAGAAGGGTAAAGGGAAGGGAGG - Intergenic
1149461094 17:56831014-56831036 CAGAGTGGTAAATGAGTGAAGGG + Intronic
1149712465 17:58755956-58755978 CAGACCGGGAAAGGGGTTGGGGG - Exonic
1152525282 17:80884839-80884861 CAGAGTGGCAACGGGGAAGGAGG - Intronic
1153185932 18:2486555-2486577 CAAAGTGAAAAAGTGGTGGGAGG - Intergenic
1156467365 18:37356344-37356366 GAGAGTGACAAAAGGGTGGGGGG + Intronic
1157584673 18:48793443-48793465 CAGAGTTGTAAATGGCTGTGGGG - Intronic
1157643084 18:49237719-49237741 AAAAGTGGTTATGGGGTGGGAGG - Intronic
1158147689 18:54334486-54334508 AAGAGTGGTTAAGAGGTGAGAGG - Intronic
1160167407 18:76526693-76526715 CAGAGAGATTTAGGGGTGGGAGG - Intergenic
1160596905 18:79982105-79982127 CAGTGTGGTCACGGGGTGGCAGG + Intronic
1160687383 19:443127-443149 CAGATGGGTAGATGGGTGGGTGG + Intronic
1161088118 19:2344314-2344336 GAGCGTGGTGATGGGGTGGGGGG - Intronic
1161528015 19:4769424-4769446 CAGAATGGCAATGGGGTGGCGGG - Intergenic
1161671352 19:5612823-5612845 CAGCTTGGTCATGGGGTGGGTGG - Intronic
1161723788 19:5917222-5917244 CAGGGTGGGAAGGGTGTGGGTGG + Exonic
1161785667 19:6324005-6324027 CAGAGTCGGAAGGGGGTGGAGGG - Intronic
1162082131 19:8224539-8224561 CAGAGTCGTGAAGAGCTGGGAGG + Intronic
1162401347 19:10448670-10448692 CAAAGTGGAAAAGGGGAGAGGGG - Intronic
1163407798 19:17134216-17134238 CATAGTGGGAAAGGGGAGGAAGG - Intronic
1163479164 19:17544485-17544507 GAGAGTGGGTAAGGGTTGGGTGG + Intronic
1163843851 19:19627966-19627988 CAGACTGGGGAAGGGGTAGGGGG + Exonic
1164083519 19:21880836-21880858 CAGACTGGGAAAGGGTGGGGGGG - Intergenic
1164084679 19:21890106-21890128 CAGACCGGGAAAGTGGTGGGGGG - Intergenic
1164446081 19:28318658-28318680 CAGTGTGGGAAAGGGAAGGGAGG - Intergenic
1164840572 19:31389622-31389644 GAGAATGGCAATGGGGTGGGGGG - Intergenic
1165174111 19:33914555-33914577 CGGAGTGGAGTAGGGGTGGGAGG + Intergenic
1165225211 19:34349863-34349885 CAGAATAGTAGTGGGGTGGGGGG + Intronic
1165943259 19:39425923-39425945 TAGAATGATAAAGGGATGGGTGG - Exonic
1166364011 19:42269471-42269493 TACAGGGGGAAAGGGGTGGGCGG + Intronic
1167709804 19:51103762-51103784 CAGATTGCCAAAGGGGTGGGAGG - Intronic
1167721082 19:51181213-51181235 CAAAGGGGTCAACGGGTGGGTGG + Intergenic
1167850022 19:52194346-52194368 GAGAATGGCAAAGTGGTGGGAGG + Intronic
1167880707 19:52455148-52455170 CAGAGAGGAAAAGTGGTTGGAGG - Intronic
1168453048 19:56480783-56480805 CAGAGTGGTCCAGTGGTGGTAGG + Intergenic
924977566 2:191987-192009 TAGAGAGGTGAAGGGCTGGGGGG + Intergenic
925735185 2:6957815-6957837 AAGATTGGAAAAGGGGTAGGAGG - Intronic
926132663 2:10314281-10314303 GAGATTGGTGCAGGGGTGGGGGG + Intronic
926447765 2:12965201-12965223 CAGAGAAGTGAAGGGCTGGGAGG - Intergenic
927201764 2:20582636-20582658 CCGAGTGGAAAGAGGGTGGGTGG - Intronic
928602410 2:32916151-32916173 CAGGGAGGTAAGGGGGAGGGAGG - Intergenic
928633105 2:33214498-33214520 AAGAGTGATAAAGTGGTAGGTGG - Intronic
928947665 2:36786432-36786454 AAGAGAGGTAAAGGGATGGATGG - Intronic
930160001 2:48145061-48145083 CACAGTAGTAGTGGGGTGGGGGG + Intergenic
930385435 2:50688495-50688517 CAGAGTGGTGCAGGACTGGGTGG + Intronic
930899140 2:56482353-56482375 CAGGGTGGTCAAGGGGTAGGTGG - Intergenic
931463688 2:62468997-62469019 CAGAGGGTAAAAGAGGTGGGTGG - Intergenic
932219160 2:69986820-69986842 GAGAGTGGGAAAGGACTGGGAGG + Intergenic
932773049 2:74512418-74512440 TAGAGTGGTCAAGGTGGGGGAGG + Intergenic
935603659 2:104948023-104948045 CAGAGTGGGAGTGGGGTGGGGGG - Intergenic
936724256 2:115293379-115293401 CAGAGTGGGCAAGAGTTGGGAGG + Intronic
937366297 2:121264390-121264412 CAGAGTGGAAATGGGGAAGGCGG + Intronic
937612596 2:123879643-123879665 CAGAGTGGAGCAGGGGTGGGAGG + Intergenic
938119450 2:128623447-128623469 CAGAGTGGGCCAGGGGTCGGGGG + Intergenic
938574255 2:132589214-132589236 CAGAGGGGCAATGGGGAGGGGGG - Intronic
938924933 2:136030261-136030283 CAGAGTGATAAAGGGAATGGGGG + Intergenic
938955688 2:136295955-136295977 AAAAGTGGTTAAGGGGTGGAAGG - Intergenic
940897918 2:159098630-159098652 CAGACTTGTAAAGGGGGGTGGGG + Intronic
941164480 2:162070939-162070961 GAGAGAGGTAAAGGAGAGGGTGG - Intronic
941574392 2:167212891-167212913 CAGAGGGGTGGGGGGGTGGGGGG - Intronic
942097948 2:172551209-172551231 CTGAGTGGTGGTGGGGTGGGGGG - Intergenic
942133972 2:172907057-172907079 CAGACTGGGGAAGGGGTGGTGGG - Intronic
943033938 2:182716770-182716792 CAGAGTGGGAGAGGGGAGAGGGG - Intronic
943061403 2:183045029-183045051 GAAAGTGGAGAAGGGGTGGGGGG - Intergenic
945712407 2:213315285-213315307 CAGGGTGGTAAAGAGGGAGGTGG - Intronic
945759372 2:213894546-213894568 AAGAGTGGTAAAGTGGTAAGTGG - Intronic
945760251 2:213904833-213904855 CAGAGTGGTAACTCGGTGGGTGG + Intronic
946871961 2:224092486-224092508 GAAAGTGGAGAAGGGGTGGGAGG + Intergenic
947016418 2:225625486-225625508 AAGAGTGGTGAATGGGTGGGAGG + Intronic
947527411 2:230886963-230886985 CAGTGAGGTAATGGGGTGGGGGG + Intergenic
1168869599 20:1117200-1117222 CAGAGAGGTACAGGGCTGGCAGG + Intronic
1168901581 20:1369486-1369508 CAGAGGGTTTAAGGGGAGGGTGG + Exonic
1169506102 20:6213245-6213267 CAGTGGGGTAAAGGGGGGGGGGG + Intergenic
1170402982 20:16007771-16007793 CAGAGGGGAAAAGGGTAGGGTGG - Intronic
1172110948 20:32544563-32544585 CTGCAGGGTAAAGGGGTGGGAGG + Intronic
1172177413 20:32980668-32980690 GAGTGTGGGGAAGGGGTGGGTGG + Intergenic
1172192218 20:33068974-33068996 GTGAGTGGTCAAGGGGTGGCTGG + Intronic
1173307358 20:41863090-41863112 CGGAGTAGGAAAGGGGTGGAGGG - Intergenic
1173863580 20:46299939-46299961 CAGAGTGGGAGGGGGCTGGGAGG - Intronic
1173941377 20:46913987-46914009 CAGAGTGGTAAAGGGGTGGGAGG - Intronic
1174098694 20:48109987-48110009 TAGAAGGGTGAAGGGGTGGGTGG - Intergenic
1174532004 20:51221731-51221753 CAGAGGGAGCAAGGGGTGGGAGG + Intergenic
1174758420 20:53182453-53182475 CATAGAGGTAACGAGGTGGGCGG + Intronic
1174814963 20:53679157-53679179 CAAAATGACAAAGGGGTGGGAGG + Intergenic
1175224885 20:57439238-57439260 CAGAGGGGTCAGGGGGTAGGAGG - Intergenic
1175770316 20:61619298-61619320 CACAGAGGTGAAGGAGTGGGGGG - Intronic
1175889368 20:62309587-62309609 GAGGGTGGTAGGGGGGTGGGAGG + Intronic
1176414660 21:6467669-6467691 CGGGGTGGGGAAGGGGTGGGGGG - Intergenic
1176426570 21:6552424-6552446 GAGGGTGGAGAAGGGGTGGGAGG - Intergenic
1178135241 21:29619484-29619506 AAGAGTGGGAAGGGGGTGAGCGG + Intronic
1179509733 21:41864717-41864739 CAGTGTGGAAAATGGGTTGGCGG - Intronic
1179690160 21:43075991-43076013 CGGGGTGGGGAAGGGGTGGGGGG - Intronic
1179702061 21:43160746-43160768 GAGGGTGGAGAAGGGGTGGGAGG - Intronic
1181450636 22:23017536-23017558 CAGAGCGACCAAGGGGTGGGAGG + Intergenic
1181643767 22:24219460-24219482 CAGAGTGGTGAGGTGTTGGGAGG + Intergenic
1181729914 22:24837581-24837603 CAGACTGGGAAAGGGGGGGGGGG - Intronic
1182715727 22:32354831-32354853 CAGAATGGTAAAATGGTGGTGGG - Intergenic
1183057342 22:35315106-35315128 CAGTGTGGAGAATGGGTGGGAGG + Intronic
1183246723 22:36699633-36699655 TCAAGTGGTTAAGGGGTGGGGGG + Intronic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1183669007 22:39261217-39261239 CAGAGTGGAGCAGGCGTGGGTGG + Intergenic
1183829187 22:40409021-40409043 GAGTGTGGAAAAGGGGTTGGAGG + Intronic
1184792242 22:46707412-46707434 CTGAGTGGGAAAGGTGGGGGCGG - Intronic
1184987051 22:48142835-48142857 CAGAGGGTTAAAGGTGTGGTGGG - Intergenic
949937421 3:9126767-9126789 CAGAAGGGTGAGGGGGTGGGAGG + Intronic
950590051 3:13930460-13930482 CAGAGTAGTAAATGGGTGAATGG + Intergenic
950634066 3:14302920-14302942 CAGTGGGGTAGAGGGGTGGCGGG + Intergenic
950698954 3:14726875-14726897 GAGAGGGGCAAAGGGGAGGGCGG - Intronic
951626733 3:24673190-24673212 GAGAGAGAGAAAGGGGTGGGGGG + Intergenic
951639337 3:24817784-24817806 AAGAGGAGAAAAGGGGTGGGGGG - Intergenic
951889165 3:27552713-27552735 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
951933082 3:27991801-27991823 CAGAGTGGTGAGGGCCTGGGTGG - Intergenic
952791881 3:37206601-37206623 GAAAGTGGAAAAGGGGTGGGAGG - Intergenic
952791894 3:37206638-37206660 GAAAGTGGAAATGGGGTGGGAGG - Intergenic
952918524 3:38267711-38267733 CAGAGGAATAAAGGGCTGGGCGG + Intronic
953100536 3:39821317-39821339 CGGGGTGGTACAGGGGTCGGGGG - Intronic
953123644 3:40070700-40070722 CAGGGTGGTAAGGGGGTGGATGG - Intronic
953258842 3:41317607-41317629 CATTTTGGTAAATGGGTGGGAGG - Intronic
954663505 3:52238264-52238286 CACAGTGGAAAATGGGAGGGAGG + Intronic
954683566 3:52358762-52358784 CAGAGGGGTGCAGGGGTGGAAGG - Intronic
955603851 3:60677306-60677328 CAGAATGATGATGGGGTGGGAGG - Intronic
956062043 3:65357494-65357516 CACAGGGGAAAAGGGTTGGGGGG - Intronic
957735058 3:84192458-84192480 GAAAGTGGAGAAGGGGTGGGGGG + Intergenic
958168873 3:89914213-89914235 CAGTGTGGTGAATGGGTGAGTGG - Intergenic
959400197 3:105891348-105891370 GTGTGTGGTAAAGGTGTGGGCGG - Intergenic
960101367 3:113746382-113746404 CAGTGTCGTAAGCGGGTGGGAGG - Intergenic
960151769 3:114256403-114256425 AAGAGTAGTAAGGGGGTGAGAGG - Intergenic
961084741 3:124057227-124057249 CAGAGTGGCAAAAGTGGGGGCGG - Intergenic
961651005 3:128416589-128416611 CAGAGTGGGAGTGGGGTGGCAGG + Intergenic
961752986 3:129108173-129108195 CAGAGGCGTGAAGGGGAGGGAGG - Intronic
961842882 3:129732380-129732402 CAGACTGGCAACAGGGTGGGTGG - Intronic
963044816 3:141094774-141094796 CAGGGGGGCAAAGGGGCGGGGGG - Intronic
964176284 3:153828271-153828293 GAAAGTGGAAATGGGGTGGGAGG + Intergenic
964176309 3:153828345-153828367 GAAAGTGGAAATGGGGTGGGAGG + Intergenic
964176322 3:153828382-153828404 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
964629419 3:158794076-158794098 CAGAAGGGTGAAGGGTTGGGAGG - Intronic
964941167 3:162158836-162158858 AAGAGCAGAAAAGGGGTGGGAGG + Intergenic
964941177 3:162158873-162158895 GAGAGTGGAAAAGAGGTGGCAGG + Intergenic
964941190 3:162158910-162158932 GAGAGTGGAAAAGGGGTGGGAGG + Intergenic
964941201 3:162158947-162158969 GAAAGTGGAAAAGGCGTGGGAGG + Intergenic
964941213 3:162158984-162159006 TAAAGTGGAAATGGGGTGGGAGG + Intergenic
964941237 3:162159058-162159080 TAAAGTGGAAACGGGGTGGGAGG + Intergenic
964941269 3:162159153-162159175 GAAAGTGGAGAAGGGGTGGGAGG + Intergenic
964941280 3:162159190-162159212 GAAAGTGGAAATGGGGTGGGAGG + Intergenic
964941309 3:162159285-162159307 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
965034505 3:163421022-163421044 GAGAGGGGTAAAGAGGTAGGGGG - Intergenic
965524481 3:169701651-169701673 CTGAGTGGTAAGGGGTCGGGGGG + Intergenic
965838089 3:172873005-172873027 CAGAGTGGTTCAGGGAAGGGAGG + Intergenic
965939476 3:174160922-174160944 CAGAGTAGTAGAGGGGTTGAGGG - Intronic
966314857 3:178633577-178633599 CACAGTGGTCACAGGGTGGGTGG + Intronic
966466819 3:180238447-180238469 CAGATTGCTTAAGGGGAGGGAGG + Intergenic
967076142 3:186004276-186004298 GAGGCTGGTTAAGGGGTGGGTGG + Intergenic
967120495 3:186378391-186378413 CGGAGTGGGAAAGGAGAGGGAGG + Intergenic
968473484 4:792277-792299 CAGAGTGGCGGAGGGGTGAGGGG - Intronic
968846140 4:3042640-3042662 CAGAGTGGAAATGGGGGTGGGGG - Intergenic
970251623 4:14122367-14122389 CAGAGGGGTGCTGGGGTGGGAGG - Intergenic
970495019 4:16616501-16616523 CAGTGGGGCAAAGGGGTGGTTGG + Intronic
971261747 4:25063497-25063519 AAGAATGGTAGAGGGATGGGAGG + Intergenic
971565874 4:28140630-28140652 TAGAGTGGAAAAGTGGTGGATGG + Intergenic
972245551 4:37243387-37243409 GAGATTGGGGAAGGGGTGGGCGG - Intergenic
972669138 4:41196881-41196903 CAGAGGGGGAAAGGAGTGTGTGG - Intronic
973015115 4:45128475-45128497 GTGGGGGGTAAAGGGGTGGGCGG + Intergenic
974125233 4:57687935-57687957 CAGTGAGGTAAAGGGATGGCTGG + Intergenic
975333823 4:73152354-73152376 CAGAGAGGAAAAGGGATGGTAGG - Intronic
975598380 4:76072736-76072758 CAGAGATGTAAGGGGGTGGTGGG - Intronic
977782620 4:100996366-100996388 GAAAGTGGAGAAGGGGTGGGAGG + Intergenic
977782631 4:100996403-100996425 GAAAGTGGAGAAGGGGTGGGAGG + Intergenic
979215509 4:118159142-118159164 CAGAGGGGCAGAAGGGTGGGTGG + Intronic
980241839 4:130188281-130188303 CATGGTAGAAAAGGGGTGGGGGG - Intergenic
981503866 4:145479607-145479629 CAGAGTGCTAAAGGAGGGGAAGG + Intergenic
981516344 4:145613820-145613842 GAGAGGGGAAGAGGGGTGGGTGG - Intergenic
981887468 4:149693982-149694004 CAGATTAGTAAAGGGATGGTGGG - Intergenic
982272607 4:153606395-153606417 CAGTGTGGTAGATGGATGGGAGG + Intronic
983219883 4:165033833-165033855 AAAAGTGGGAAAGGGGTGGTTGG + Intronic
983886167 4:172982977-172982999 CAGAAGGGTGAATGGGTGGGAGG + Intronic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
985145323 4:186889727-186889749 CAGAGCGGCAAAGGGTTGTGTGG - Intergenic
985874570 5:2585249-2585271 CAGATAGGTAAATGGGTGGATGG + Intergenic
987853433 5:23387060-23387082 CAGAGTGGTTCAGGGAAGGGAGG + Intergenic
988609713 5:32712744-32712766 CAGGGAGGTGAAGGGGTTGGAGG + Intronic
990509128 5:56474499-56474521 CACAGGGGTGATGGGGTGGGAGG + Intronic
991066223 5:62427730-62427752 AAGAGGGGTAAAGGGCAGGGGGG - Intronic
992067125 5:73119310-73119332 CAGAGAGGTAAAGAGGGGAGGGG - Intergenic
992209986 5:74469410-74469432 GGGAGTGGGAGAGGGGTGGGCGG - Intergenic
992452227 5:76885306-76885328 GAAAGTGGAGAAGGGGTGGGAGG + Intronic
992452273 5:76885453-76885475 GAAAGTGGGAACGGGGTGGGAGG + Intronic
992452298 5:76885527-76885549 GAAAGTGGGAACGGGGTGGGAGG + Intronic
992452323 5:76885601-76885623 GAAAGTGGGAATGGGGTGGGAGG + Intronic
992452337 5:76885638-76885660 GAAAGTGGGAACGGGGTGGGAGG + Intronic
992452351 5:76885675-76885697 GAAAGTGGGAATGGGGTGGGAGG + Intronic
992452364 5:76885712-76885734 GAAAGTGGGAACGGGGTGGGAGG + Intronic
994619076 5:102141581-102141603 CAGAGTGATAAAGGGGTAGTAGG + Intergenic
994719376 5:103363574-103363596 TTGAGTGGAAATGGGGTGGGTGG + Intergenic
995554011 5:113309139-113309161 GAGAGTGGTAAAGGAGTTGGGGG - Intronic
997600643 5:135136097-135136119 CAGAGCGGGAAATGGGTGGGAGG + Intronic
998457440 5:142284220-142284242 CAAAGAGGTAGAGGGGTGGTGGG - Intergenic
999136156 5:149320756-149320778 CAGAGTGGTAAACAGGAGGAGGG - Intronic
999223956 5:150004507-150004529 CTTTGTGTTAAAGGGGTGGGTGG + Intronic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
1000001531 5:157143253-157143275 AAGAGTGGTAATGGGGAAGGGGG - Intronic
1001019051 5:168167368-168167390 CAGGGTGATAAAGGGGAGTGGGG - Intronic
1001155489 5:169269249-169269271 CAGAGTGGTTAAGGAGAGGGAGG - Intronic
1001450421 5:171820306-171820328 CAGAGCAGGAAAGGGCTGGGCGG + Intergenic
1002236605 5:177807892-177807914 CAGAGTGGTAGAAGGGAGGATGG + Intergenic
1002475406 5:179462256-179462278 CAGTGTGGTCCAGGGGTGTGAGG - Intergenic
1003321450 6:5055671-5055693 CTGAGTGGTTTAGGGGTGGAGGG - Intergenic
1003448339 6:6205955-6205977 CAGAGTGGTAAAAGGGGGTAGGG - Intronic
1005575536 6:27186025-27186047 CAGAGGGGGAAAGGTGAGGGAGG - Intergenic
1006557086 6:34876407-34876429 CTTAGTGGTAAACGGGTTGGGGG + Exonic
1007448411 6:41924761-41924783 CAGAGTGGAAAATGAGTTGGAGG + Intronic
1007597776 6:43062177-43062199 CTGAGGGGTAATGGGGTTGGAGG + Intronic
1007716437 6:43858844-43858866 CAGAGACTAAAAGGGGTGGGGGG - Intergenic
1008296071 6:49779263-49779285 CAGAGAGGTAAAGGGTTAGCAGG - Intergenic
1008367927 6:50704417-50704439 AAGACTGGAAAAGGGATGGGTGG + Intergenic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1008867286 6:56228052-56228074 GAGAGTGGGAAAGGGGTGAGGGG + Intronic
1009039528 6:58159543-58159565 CCGAGTGGAAAAGGACTGGGTGG + Intergenic
1009397113 6:63212478-63212500 CAGAGGGTTTAAGGGGAGGGTGG - Exonic
1010954193 6:82071498-82071520 CAGGGTAGTAAAGGGATGGGGGG + Intergenic
1011277252 6:85643150-85643172 CAGTGGGGTAAAGGAGCGGGGGG - Exonic
1012545446 6:100413877-100413899 CAGAAGGGTAAAGAGGTGGAAGG - Intronic
1013754803 6:113448701-113448723 CAGAGTTCTAAAGTGTTGGGAGG - Intergenic
1014535369 6:122607583-122607605 CAGAGTAGTTAAGAGGTGGGAGG - Intronic
1015318015 6:131839298-131839320 CAGAATGGTAAAGGGGAGAGGGG - Intronic
1016466959 6:144335364-144335386 CAGAGTTGCAAAGGAGCGGGTGG - Intronic
1016857219 6:148683320-148683342 CAGAGTGCCAAAGGGTTAGGGGG - Intergenic
1018077421 6:160229611-160229633 AAAAGTGTAAAAGGGGTGGGAGG - Intronic
1018627431 6:165792951-165792973 CACAGTGGTGCTGGGGTGGGGGG + Intronic
1019051686 6:169188438-169188460 CAGAGTGGCCATGGGGTTGGAGG + Intergenic
1019438054 7:1031862-1031884 CAGAGTGGTCCAGGTGCGGGGGG + Intronic
1020087160 7:5316711-5316733 AAGAATGGGAAAGGGGAGGGCGG + Intronic
1022239592 7:28497097-28497119 CCTGGTGGTAAAGGAGTGGGAGG + Intronic
1023234138 7:38066079-38066101 CAGCAGGGTAAAGTGGTGGGGGG - Intergenic
1023284835 7:38608304-38608326 CAGAGAGATAAAGGGCTGGATGG - Intronic
1023494289 7:40778007-40778029 TAGAGTGGAAAGGTGGTGGGAGG - Intronic
1023611065 7:41971750-41971772 CAGAGGAGCACAGGGGTGGGAGG - Intronic
1023652757 7:42388791-42388813 CAGAGTGGAAAGGGCGTGTGAGG - Intergenic
1023735655 7:43234172-43234194 CAGGGTGGGAGAGGTGTGGGTGG - Intronic
1024509892 7:50195696-50195718 AAGAGTGGTAAAGGAGAGAGAGG + Intergenic
1025110740 7:56214097-56214119 AAGAGTGGGAAGGGGGTGAGGGG - Intergenic
1025207145 7:57000447-57000469 AAGAATGGGAAAGGGGAGGGCGG - Intergenic
1025664791 7:63576443-63576465 AAGAATGGGAAAGGGGAGGGCGG + Intergenic
1026405883 7:70065055-70065077 CAGAGATGTGAAGTGGTGGGGGG + Intronic
1026829358 7:73601512-73601534 CAGGGTGGGAAAGGGGTGCAGGG + Intronic
1027157628 7:75779990-75780012 GAAAGTGGAAAAGGGGTAGGAGG - Intronic
1027157657 7:75780090-75780112 GAAAGTGGAAAAGGGATGGGAGG - Intronic
1027157691 7:75780202-75780224 GAAAGTGGAGAAGGGGTGGGAGG - Intronic
1028767689 7:94578552-94578574 GAGACTGGCAAATGGGTGGGGGG - Intergenic
1029175683 7:98662778-98662800 CTGAGTGGGAAAGAGGTCGGGGG - Intergenic
1029606268 7:101601221-101601243 CAGTGTGGAAAAGGGGCAGGTGG + Intergenic
1029917804 7:104230508-104230530 GAGACTGGAAAAGGGGTAGGTGG + Intergenic
1031525119 7:122816172-122816194 GATAGTGGGTAAGGGGTGGGTGG - Intronic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032506404 7:132437895-132437917 AAGAGAGGTGAAGAGGTGGGAGG + Intronic
1032803723 7:135336332-135336354 TTGAGTGGTGAATGGGTGGGTGG - Intergenic
1033454015 7:141486244-141486266 CAGAAAGGTGAGGGGGTGGGAGG + Intergenic
1034265335 7:149777911-149777933 CAGAGTGGAAAAGGGGGCTGGGG - Intergenic
1035376615 7:158410914-158410936 CAGTGTGCTCATGGGGTGGGAGG + Intronic
1035708253 8:1694217-1694239 AAGAGTGGTACAGGGAGGGGTGG + Intronic
1036474637 8:9082032-9082054 AAGAGTTCTAATGGGGTGGGGGG - Intronic
1037548233 8:19944455-19944477 GAGAGAGAGAAAGGGGTGGGGGG + Intronic
1037601017 8:20394028-20394050 CACAGTTGGACAGGGGTGGGAGG + Intergenic
1039487376 8:37921628-37921650 CCCAGTGGGGAAGGGGTGGGTGG - Intergenic
1039719915 8:40152109-40152131 CAGAGTTGTACAGGAGTGGAAGG - Intergenic
1042339209 8:67661338-67661360 TAGAGTGGTACAGAGGCGGGAGG + Intronic
1042659309 8:71135934-71135956 CAGAGTGGTGGATGGGTGGCAGG - Intergenic
1042714805 8:71761042-71761064 CACAGTGGAAAAGGGGGTGGGGG + Intergenic
1042905256 8:73766044-73766066 GAGAGAGGAAAAGGGGAGGGAGG + Intronic
1042953021 8:74220551-74220573 AAGAATGTTAAGGGGGTGGGTGG - Intergenic
1043002541 8:74777258-74777280 CAGTGTGAGGAAGGGGTGGGGGG + Intronic
1043941366 8:86199130-86199152 CAGGGTGGGACAGGGGTGGACGG - Intergenic
1046368875 8:113273509-113273531 CAGCTTGGCAAAGGGATGGGTGG - Intronic
1046549013 8:115688936-115688958 CAGAATGGTGAAGGGGAAGGAGG - Intronic
1047464744 8:125101529-125101551 CACAGTTTTAAAGGGATGGGAGG - Intronic
1047681128 8:127255305-127255327 CAGAGAGGGGCAGGGGTGGGGGG + Intergenic
1048360012 8:133689612-133689634 CAGATTTGTAAAGTGGGGGGTGG + Intergenic
1049272857 8:141705294-141705316 CTGAGAGGTAAAGAGGTGAGGGG + Intergenic
1049319510 8:141988532-141988554 GAGAGTGGGAAAGGGGAGGGAGG - Intergenic
1049599041 8:143498704-143498726 CAGAGGGGTACAGGGCGGGGCGG + Intronic
1049610511 8:143552892-143552914 CAGAGTGGGAAAGGCGGGGAGGG + Intergenic
1049770108 8:144376025-144376047 CAGAGAGGTTATGGGTTGGGGGG - Intronic
1049802319 8:144523596-144523618 CACAGAGCTAAAGGGGAGGGGGG - Exonic
1050612602 9:7368696-7368718 CAGAGGGGTGCAGGGATGGGGGG + Intergenic
1051126977 9:13815701-13815723 GAGAGTGGTAATGGGATTGGAGG - Intergenic
1051256188 9:15216311-15216333 TTGAGTGGTAAATGGGTGGATGG + Intronic
1051678510 9:19582888-19582910 GGGAGTGGGAAAGGGGTGGAAGG - Intronic
1052161929 9:25273041-25273063 GGCAGAGGTAAAGGGGTGGGGGG - Intergenic
1052851443 9:33380795-33380817 CAGAGAAGTAAAGGGGATGGTGG - Intergenic
1055727213 9:79243805-79243827 CAGGGTGGTATAGGGGTGTCAGG - Intergenic
1056482081 9:87015999-87016021 CAGAGAGGTCATGGGGTGGAGGG + Intergenic
1058666129 9:107317622-107317644 CAGAGGGGTAAAGATGTTGGTGG + Intronic
1058882968 9:109301440-109301462 CTGAGTGGTAGAGGAGTGTGGGG - Intronic
1059634536 9:116158044-116158066 GGGAGTGGGACAGGGGTGGGAGG - Intronic
1060926461 9:127458865-127458887 CTGAGTGGGAAAGGAGTGGCAGG + Intronic
1061712629 9:132498553-132498575 CAGGGTGGCACAGGAGTGGGTGG - Intronic
1061932263 9:133839157-133839179 ATGAGTGGTAGATGGGTGGGTGG + Intronic
1061938322 9:133870945-133870967 CAGATGGGTAGACGGGTGGGTGG + Intronic
1062053329 9:134458324-134458346 CAGAGTGGGAAGGGGGTCTGTGG - Intergenic
1062612311 9:137380590-137380612 CAGAGGGGCATTGGGGTGGGGGG - Intronic
1186269054 X:7865287-7865309 AAGAGTAATAAAGTGGTGGGAGG + Intergenic
1187310715 X:18138652-18138674 CAGAGGGGTAGGGGTGTGGGAGG + Intergenic
1187377434 X:18767822-18767844 GAGAGTGGTGAGGGGGTTGGGGG + Intronic
1187542144 X:20207256-20207278 CAGAGTGGGATAGGGGAGGTAGG + Intronic
1188373476 X:29397985-29398007 CAGACTAGTGAAGTGGTGGGTGG + Intronic
1189052088 X:37656468-37656490 CAGATAGATAAAGGGGTTGGGGG - Intronic
1189289918 X:39877804-39877826 AAGAGTGGGAAAGGGAGGGGTGG - Intergenic
1189326873 X:40117987-40118009 GAGGGAGGAAAAGGGGTGGGGGG - Intronic
1189701060 X:43716555-43716577 CAGAGTGGTAGAGGGGAGATAGG + Intronic
1190869604 X:54414019-54414041 CAGGGTGGTAGTGGGGTGGAGGG + Intergenic
1191098080 X:56695817-56695839 TAAAATGGTAAAGTGGTGGGAGG + Intergenic
1192148644 X:68698277-68698299 CAGAGTTAAAAAGGGGTAGGGGG + Intronic
1192154000 X:68729848-68729870 AAGGGTAGTAAGGGGGTGGGTGG + Intergenic
1192180416 X:68912454-68912476 GAGAGAAATAAAGGGGTGGGGGG - Intergenic
1192342733 X:70277551-70277573 CAGAGGGGTTCTGGGGTGGGAGG - Intronic
1192608792 X:72546787-72546809 GAGTGTGGTAAAGGAGTGTGGGG - Intronic
1195291409 X:103434343-103434365 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291423 X:103434381-103434403 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291437 X:103434419-103434441 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195291451 X:103434457-103434479 GAAAGTGGAAAAGGGGTGGGAGG + Intergenic
1195327045 X:103766360-103766382 GAAAGTGGAGAAGGGGTGGGGGG + Intergenic
1197301057 X:124781328-124781350 CCGAGTGCTAGAGGGGTTGGTGG - Intronic
1197563817 X:128056166-128056188 CTGAGTTGGAAAGGGGTGGAAGG + Intergenic
1197903916 X:131403110-131403132 AAGAGTGGTACAGGAATGGGTGG + Intergenic
1198060823 X:133044094-133044116 GAGAGTAGTAGATGGGTGGGTGG - Intronic
1198233496 X:134715447-134715469 CAGTGTGTTAGGGGGGTGGGGGG - Intronic
1198965720 X:142227608-142227630 GAAAGTGGAGAAGGGGTGGGAGG - Intergenic
1199174139 X:144764648-144764670 CAGAGAGATAAGGGGGTGAGAGG + Intergenic
1199660256 X:150042360-150042382 AAGGGTAGTAAAAGGGTGGGTGG - Intergenic
1199672993 X:150162111-150162133 CATGGTGGTAAAGGGATGGGAGG + Intergenic