ID: 1173941510

View in Genome Browser
Species Human (GRCh38)
Location 20:46914926-46914948
Sequence CTGCCTTCAAAGCTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173941510 Original CRISPR CTGCCTTCAAAGCTGGAGTA TGG Intronic
900210462 1:1453237-1453259 CTGTCTTCCAGGCTGGAGTGCGG + Intronic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901442548 1:9287301-9287323 CTGCCTTCACAGCCCCAGTAAGG - Intergenic
901787530 1:11634556-11634578 CTGCCCTCACAGAGGGAGTATGG - Intergenic
904128809 1:28260481-28260503 CTCCCTCCAAAGCAGGAGTGCGG - Intronic
904197336 1:28795565-28795587 CTGCTTCCGAGGCTGGAGTACGG - Intergenic
905956035 1:41996889-41996911 CTGCCTTCAAAGATGGTAGAAGG - Intronic
906689742 1:47784768-47784790 CGGCCTGCAAAGCAGGAGAAAGG - Intronic
907391433 1:54160816-54160838 CTGCTTCCAAAGCTGGGGCAGGG + Intronic
908382647 1:63611396-63611418 CTTCCTGCAATGCTGGAGTTAGG - Intronic
908696341 1:66846411-66846433 CAGCTTTCAAAGATGGATTAAGG - Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911430185 1:97774959-97774981 CTGCATGCCAAACTGGAGTAGGG + Intronic
912503390 1:110137401-110137423 CTTCCTTCCAGGCTGGAGTTTGG + Intergenic
912757294 1:112334893-112334915 CTGTCACCAAGGCTGGAGTACGG - Intergenic
913018608 1:114764393-114764415 CTGCTTTCACAGCTGGCGTTAGG - Intergenic
916092822 1:161321632-161321654 TTGCCTTCAAAGCTGGAAAGAGG + Intronic
919645091 1:200087429-200087451 CTGTCTCCCATGCTGGAGTACGG + Intronic
919734221 1:200935489-200935511 CTGCCTCCCAGGCTGGAGTGCGG - Intergenic
919885008 1:201927143-201927165 TTGCCTTAAAAGCAGGAGAAGGG - Intronic
920724644 1:208422768-208422790 CTGCCACCCAGGCTGGAGTACGG + Intergenic
921338692 1:214112556-214112578 CTGTCTTCCACGCTGGAGTGCGG - Intergenic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
922687906 1:227661827-227661849 CAGCCTGCAAAGCTGAAGTCAGG + Exonic
922746858 1:228049068-228049090 CAGCCTTCCAAGCTGGAGGCAGG + Intronic
1062960857 10:1572910-1572932 CTGCCTACAGTGCTGCAGTAGGG - Intronic
1063153174 10:3355136-3355158 CTGCCTTCAGAGATGGAGTCAGG + Intergenic
1064427756 10:15245100-15245122 CTGTCATCCAAGCTGGAGTGTGG + Intronic
1064577599 10:16761817-16761839 CTGTCGTCGAGGCTGGAGTATGG - Intronic
1065317815 10:24481522-24481544 CTGACTTCCAAGCTGGACTTTGG - Intronic
1065400925 10:25300287-25300309 CTGCCTTTGAAGCTGGAAGAAGG - Intronic
1066362551 10:34745323-34745345 CTGTCATCCAAGCTGGAGTGTGG - Intronic
1066374792 10:34848127-34848149 CTTCTTTCAAAGTTGGAGTCTGG + Intergenic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1067067764 10:43113299-43113321 CTGCCTCCAAAACTGGAGCCTGG - Intronic
1068336415 10:55637709-55637731 CTGTCTCCCAAACTGGAGTACGG - Intergenic
1069047197 10:63755493-63755515 CTGCCTTTAACACTGGAGTTGGG + Intergenic
1069749038 10:70734040-70734062 CTGCCCTCAGAGCTGGGATAGGG + Intronic
1069845729 10:71369894-71369916 CTGCCTTAAAAGATTGAGAAGGG + Intergenic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1072564960 10:96609807-96609829 CTGCCTGCAAAAGTGGAGTTTGG - Exonic
1072600000 10:96916649-96916671 CTGTCTCCCAAGCTGGAGTACGG + Intronic
1073334777 10:102698236-102698258 CTGTCTTCCAGGCTGGAGTGTGG + Intronic
1073607977 10:104915081-104915103 CTGCCTTCCATGGTGGAGGAGGG - Intronic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1074232822 10:111554826-111554848 CTGAGTTCAAAGCTAGAGTTTGG + Intergenic
1075750006 10:124760452-124760474 CTGCCTCCAAAGCTGAACTTGGG + Exonic
1076771622 10:132669214-132669236 CTGTCTCCAAGGCTGGAGTGCGG - Intronic
1077834639 11:5915013-5915035 CTGCCCTCAGAGGTGGAGTCAGG - Intronic
1078565345 11:12409599-12409621 CTGGCTTTTAAGATGGAGTAAGG + Intronic
1078619635 11:12895159-12895181 CTTCCTTCAAAGCTGCTCTATGG - Intronic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1079445484 11:20553032-20553054 CTGCCACCCAGGCTGGAGTACGG - Intergenic
1080511161 11:32973014-32973036 CTGGCTTCAAGGCAGGAGAAAGG - Intronic
1080615158 11:33939345-33939367 CTGACTTTGAAGCTGGAGGAAGG + Intergenic
1081857709 11:46314199-46314221 CTGCCACCCAGGCTGGAGTACGG - Intronic
1082277134 11:50233870-50233892 CTGTCACCAAGGCTGGAGTACGG - Intergenic
1083049650 11:59765765-59765787 CTATCTTCCAGGCTGGAGTACGG - Intronic
1083870792 11:65487286-65487308 CCACCTTCTAGGCTGGAGTAAGG - Intergenic
1084380527 11:68809625-68809647 CTGCCTTCAAAAGTGGAGTCAGG - Intronic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1085404595 11:76254477-76254499 CTGCCTTTAAAGCTGCAGAGAGG - Intergenic
1085574288 11:77588934-77588956 CTGCTTTGAAAGCAGGAATACGG - Intronic
1086416122 11:86590515-86590537 TTGCTTTCAAAGCTGGAGGCAGG + Intronic
1088489590 11:110373999-110374021 CTGTCATCCAGGCTGGAGTACGG + Intergenic
1089075502 11:115735352-115735374 CTGTCTTCCAGGCTGGAGTGCGG + Intergenic
1089616500 11:119697809-119697831 CTGCCTAGAAAGCTGGAATCTGG - Intronic
1089676079 11:120090602-120090624 CTGCCTGGCAAGATGGAGTATGG - Intergenic
1090241167 11:125182853-125182875 CTGCCTTCAAGGCTGGGCTGAGG + Intronic
1090469773 11:126969755-126969777 ATCCCTTCAAAGCTGGAGATTGG + Intronic
1091560649 12:1610350-1610372 CTGCTTTCACTGCTGAAGTAGGG + Intronic
1092565924 12:9665363-9665385 CTGGCTTTAAAGCTGTAGCAAGG - Intronic
1093462090 12:19416143-19416165 CTGTCACTAAAGCTGGAGTACGG - Intronic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1094332102 12:29305168-29305190 CTGTCACCCAAGCTGGAGTATGG + Intronic
1094442211 12:30490873-30490895 CAGCTTCCTAAGCTGGAGTATGG + Intergenic
1094782976 12:33814329-33814351 TTGGGTTCAAAACTGGAGTAAGG + Intergenic
1095391148 12:41708062-41708084 CTGTCTCCCAAGCTGGAGTGCGG + Intergenic
1095482370 12:42649789-42649811 CTGCCTTAGAAGCTGGGGCATGG + Intergenic
1096999090 12:55861293-55861315 CTGTCTGCCAAGCTGGAGTGCGG + Intergenic
1097111945 12:56666662-56666684 TTGTCGTCCAAGCTGGAGTATGG + Intronic
1099610347 12:84859908-84859930 TTGCCTTTAAAGATGGAGAATGG + Exonic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1101330447 12:103753566-103753588 CTGCCTTCAGAGATGTTGTAAGG - Intronic
1101562060 12:105865864-105865886 CTGTCATCCAAGCTGGAGTGAGG - Intergenic
1102017058 12:109655122-109655144 CTGCCATCCAGGCTGGAGTGCGG + Intergenic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102970413 12:117161799-117161821 CTCCCTTCAAGGCTGAAGGATGG - Intronic
1103992296 12:124807356-124807378 CTGGCCTCAAAGGTGGAGGAAGG + Intronic
1104124926 12:125837438-125837460 CTGCCTTCAAAGGCTGAGGAAGG + Intergenic
1106321595 13:28644418-28644440 CTGACTCCCAGGCTGGAGTACGG - Intergenic
1106887673 13:34207240-34207262 CTGGCTTTTAAGGTGGAGTAAGG - Intergenic
1107900028 13:45002717-45002739 CTGCCTCCAAAGCAAGAGTCTGG + Intronic
1108216871 13:48194168-48194190 CTGCCACCCAGGCTGGAGTACGG + Intergenic
1108365730 13:49710223-49710245 CTGTCGCCCAAGCTGGAGTATGG - Intronic
1108923160 13:55701875-55701897 CTGTCATCCAGGCTGGAGTACGG + Intergenic
1109163438 13:59004096-59004118 CTGTCTTCCAGGCTGGAGTGTGG + Intergenic
1110257721 13:73450639-73450661 CAGCCTTCAAGGCAGGAGAAGGG - Intergenic
1110597784 13:77338100-77338122 CTGGCTTTAAAGGTGGAGGAAGG + Intergenic
1110707088 13:78608589-78608611 CCGCATTCAAAGCTGGAAGAAGG + Intergenic
1110838303 13:80110423-80110445 CTGGCTTGGAAGATGGAGTAAGG + Intergenic
1111311128 13:86487626-86487648 CTGGCTTTAAAGATGGGGTATGG - Intergenic
1111813018 13:93115644-93115666 CTTTCTTCCAGGCTGGAGTACGG + Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1114719277 14:24862874-24862896 CCGCCTGCAAAGTTGGTGTAGGG - Intronic
1114843302 14:26291203-26291225 CTGCTTTCAAGGCTGGTGTTGGG + Intergenic
1115840600 14:37465390-37465412 TTGCCTGCATAGCTGGTGTATGG - Intronic
1117100067 14:52336341-52336363 CTGACTTCAAAACTGGGGCAGGG + Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117649228 14:57885251-57885273 CTGCATTCAAAGGTACAGTAGGG - Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1119363341 14:74070139-74070161 CAGCCTTCAAAGTTAGATTAAGG - Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119512637 14:75223498-75223520 CTGTCATCCAAGCTGGAGTGTGG + Intergenic
1119998594 14:79279032-79279054 GTGCCTTCATGGCTGGAGTTTGG + Intronic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120781428 14:88489611-88489633 CTGTCTTCCAGGCTGGAGTGTGG - Intronic
1121940435 14:98065004-98065026 CAGCCTGCAGAGCTGGAGAAAGG + Intergenic
1122556972 14:102585738-102585760 CTGGCTGCAAGGCTGGAGTTAGG + Intergenic
1122614085 14:103004830-103004852 CTGTCGTCCAGGCTGGAGTACGG - Intronic
1122938095 14:104969144-104969166 CTGCCTCCAAGGCTGCAGGAGGG + Intronic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1124104782 15:26727561-26727583 CTGATTTCAAGGCTGGGGTAGGG - Intronic
1124332310 15:28831412-28831434 CTGCCTCCCAGGCTGGAGTGCGG + Intergenic
1124785576 15:32676623-32676645 CTACCTTCAGAGCTAGTGTAGGG - Intronic
1125870318 15:43094390-43094412 CTGTCTTCCAGGCTGGAGTGTGG - Intronic
1126615744 15:50577515-50577537 CTGTCGTCCAGGCTGGAGTAGGG - Intronic
1127944263 15:63734128-63734150 CTGTCATCCACGCTGGAGTAGGG - Intronic
1128295856 15:66518860-66518882 CTGCCTTTAAAACAAGAGTAAGG - Exonic
1129860368 15:78855798-78855820 CTGCCACCCAGGCTGGAGTACGG - Intronic
1130323353 15:82858324-82858346 CTGTCATCCAAGCTGGAGTGTGG + Intronic
1131144952 15:90004569-90004591 TTGACTTCAAAGCTGGAAGAAGG + Intronic
1131865558 15:96704943-96704965 CTGCCATCAAATATGGAGTCGGG + Intergenic
1133106353 16:3512379-3512401 CTGCCTTCAAATCTGCAATCTGG - Exonic
1133481263 16:6172979-6173001 CTGGCTTCGAAGATGGAGAAAGG - Intronic
1133946404 16:10352666-10352688 CTGTCATCCAAGCTGGAGTGTGG + Intronic
1134680816 16:16123979-16124001 CTGCCATCCAGGCTGGAGTGTGG - Intronic
1134842458 16:17412705-17412727 CTGCCTTCCAAGATGGTGGATGG - Intronic
1135088796 16:19495800-19495822 CTGTCTCCCAAGCTGGAGTGCGG - Intronic
1135459343 16:22627995-22628017 GTTCCTTCAATGCTGGATTATGG + Intergenic
1135635667 16:24073366-24073388 CTGTCTCCCAGGCTGGAGTACGG + Intronic
1135890721 16:26354674-26354696 CTGCCATCCATGCTGGTGTAGGG - Intergenic
1135987024 16:27191365-27191387 CTGCCATCAAGGCTGGTGTTCGG + Intergenic
1136571190 16:31097952-31097974 CTGTCATCCAGGCTGGAGTACGG + Intergenic
1139310989 16:66027926-66027948 CTGTCATCCAGGCTGGAGTATGG - Intergenic
1139860550 16:70017080-70017102 CTGCCTTCTAAGTGGGAGTCTGG - Intergenic
1141146915 16:81537496-81537518 CTGTCACCCAAGCTGGAGTACGG - Intronic
1141205800 16:81932398-81932420 CTGTCTTCGATGATGGAGTAAGG + Intronic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1142404918 16:89883087-89883109 CTGCCTTCAGAGATGAGGTAAGG - Intronic
1142834932 17:2578038-2578060 CTGTCGTCCAGGCTGGAGTACGG - Intergenic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143374442 17:6458954-6458976 CTGCCTTCGATGCTGGACCAAGG + Intronic
1143873181 17:9972224-9972246 CTGCCTTCATAGCGGGTGGATGG - Intronic
1144106712 17:11992692-11992714 CTGCCTGAAAAGCTGGCGTGCGG + Exonic
1144845369 17:18215252-18215274 CTGCCGCCCAGGCTGGAGTACGG + Intergenic
1145890441 17:28411084-28411106 CTGCCCTCAAATCTGGAGGCAGG - Intergenic
1145947522 17:28788273-28788295 CTGTCATCCAGGCTGGAGTATGG + Intronic
1146886880 17:36476860-36476882 ATGACTTCAAAGCTGGATAAAGG - Intergenic
1148819561 17:50352800-50352822 CTGGCTTGAAAGCTGAAGCAGGG - Intronic
1148906999 17:50918325-50918347 CTGTCCTCAAAGCTGCAGTCAGG - Intergenic
1150338858 17:64349549-64349571 CTGTCACCCAAGCTGGAGTACGG - Intronic
1150476526 17:65479967-65479989 CTGCCTCCTAGGCTGGAGTGTGG + Intergenic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1151602032 17:75111897-75111919 CTGCTCTAAATGCTGGAGTATGG + Intronic
1151737724 17:75955197-75955219 CTGTCATCTAGGCTGGAGTACGG + Intronic
1151827965 17:76533999-76534021 CTGTCACCCAAGCTGGAGTACGG - Intronic
1152712614 17:81880949-81880971 CTGTCTTCTAAGCTGGAGTGCGG - Intergenic
1153167349 18:2277797-2277819 CTGGCTTCAAAGCTGAAAGAAGG - Intergenic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1155292857 18:24358775-24358797 CTGTCATCCAAGCTGGAGTGCGG + Intronic
1155639159 18:27992744-27992766 CTGCGTTCCAGGCTGGTGTATGG + Exonic
1155818393 18:30345100-30345122 CTGCATTCAGAGTTAGAGTAAGG - Intergenic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1157104005 18:44756178-44756200 CTGCCACCCAGGCTGGAGTACGG - Intronic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157238040 18:45982350-45982372 CTGCCTCCAACGCTGGAGAGTGG - Intergenic
1157712223 18:49857943-49857965 CTGCCTGGAAAGCTGGAATCTGG - Intronic
1158012778 18:52748244-52748266 CTGCCTTCGATGCTGGTGTCTGG + Intronic
1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG + Intergenic
1160588566 18:79927144-79927166 CTGCCTGCTCAGCTGGAGTGGGG - Intronic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162090823 19:8278816-8278838 TTGGCTCCCAAGCTGGAGTACGG - Intronic
1162093056 19:8293654-8293676 TTGGCTCCCAAGCTGGAGTACGG - Intronic
1162891325 19:13735276-13735298 CTGTCTTCCAGGCTGGAGTGCGG - Intronic
1162940995 19:14009096-14009118 CTGCCTTCAAAGCTGGGAACAGG + Intergenic
1163184374 19:15627793-15627815 CTGCCTCCCAAACTGGAGTGCGG + Intronic
1163764457 19:19154978-19155000 CTGCCTCCAGAGTTGGTGTAGGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165356282 19:35306080-35306102 CTGTCATCCAGGCTGGAGTAGGG - Intronic
1165400386 19:35596010-35596032 CTGTCTTCCAGGCTGGAGTGTGG - Intergenic
1165492127 19:36130016-36130038 CTGTCATCCAGGCTGGAGTATGG + Intergenic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1167064836 19:47177393-47177415 CTGCTTTCCAGGCTGGAGTGTGG + Intronic
1167282561 19:48578543-48578565 CTGCCACCCAAGCTGGAGTGCGG - Intronic
1168013984 19:53556672-53556694 CTGTCATCAAGGCTGGAGTGCGG + Intronic
1168244644 19:55105903-55105925 CTGCCTCCCAGGCTGGAGTGCGG - Intronic
1168350606 19:55673848-55673870 CTGCCTTCAGTGCTGGGGTTGGG + Intronic
1168440827 19:56365669-56365691 CTGCCTCCAAAGTTGGAGACAGG + Intronic
1168499492 19:56881378-56881400 CTGTCTCCCAGGCTGGAGTACGG + Intergenic
926249303 2:11144714-11144736 CTGGCTTCAAAGACGGAGTAAGG - Exonic
927228912 2:20800668-20800690 CTGCCCCCCAGGCTGGAGTACGG + Intronic
927675904 2:25106001-25106023 CTGCCTTCCAAGCTGCACTCTGG - Intronic
928340613 2:30440077-30440099 CTGACTTCAAAGGTGGAGGAAGG + Intergenic
930322382 2:49872999-49873021 CTGTCATCCAGGCTGGAGTACGG + Intergenic
933855040 2:86404582-86404604 CTGCCTTATAAGCTGGAGTGAGG - Intergenic
934061466 2:88298033-88298055 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
934508322 2:94915232-94915254 CTGGCTTCAAAGCTGGAAGGAGG - Intergenic
935554243 2:104490387-104490409 CTTCATTTAAAGCTGGAGTATGG - Intergenic
935582904 2:104774264-104774286 CTGCCCTCAGTGCTGGTGTAGGG + Intergenic
936467578 2:112766929-112766951 CTGCCTCCCATGCTGGAGTGCGG - Intergenic
936596133 2:113849914-113849936 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
936954318 2:118009332-118009354 CTGTCGTCCAGGCTGGAGTACGG - Intronic
937196764 2:120164249-120164271 CTGTCATCCAGGCTGGAGTACGG + Intronic
937288359 2:120767159-120767181 CTGCCTTCAAGGCAGGAGCTGGG + Intronic
937350237 2:121155888-121155910 CTGTCATCAAAGCTGGAGAGGGG + Intergenic
938090731 2:128432939-128432961 CTGTCCCCCAAGCTGGAGTATGG + Intergenic
940331074 2:152475529-152475551 CTGTCATCCAGGCTGGAGTACGG + Intronic
940341693 2:152588265-152588287 TTGGCTTTAAAGCTGGAGGAAGG - Intronic
941495788 2:166200670-166200692 CTGTCGCCAAAGCTGGAGTGCGG + Intronic
941958395 2:171228512-171228534 CTGTCTTCCAAGCTGGAGTGCGG - Intronic
942871508 2:180740109-180740131 CTGTCATCTAAGCTGGAGTGCGG + Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
942963692 2:181863837-181863859 CTGCCACCCAGGCTGGAGTATGG + Intergenic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
944752441 2:202724092-202724114 CTGTCATCCAGGCTGGAGTACGG + Intronic
946566141 2:220967580-220967602 CTGCCGTCCAGGCTGGAGTGCGG - Intergenic
946895204 2:224317426-224317448 CTGCCTTCCAACCTGGGCTACGG + Intergenic
947140613 2:227016551-227016573 CTGGCTCCAAAGCTGAAGCAGGG + Intronic
947384035 2:229572442-229572464 CTCCCTTTCAAGCTGAAGTAAGG - Intronic
947447322 2:230173947-230173969 CTGCCTGCAAAGATTGTGTATGG - Intronic
948611962 2:239175672-239175694 GTGCCTTCAAAGCAGGTGTGAGG - Intronic
1169362887 20:4966029-4966051 CTGTTATCCAAGCTGGAGTATGG - Intronic
1169363462 20:4971442-4971464 CTGTCATCCAAGCTGGAGTGCGG - Intronic
1169713511 20:8590671-8590693 CTGCCTTTGAAGTTGGAGGAAGG - Intronic
1169854150 20:10085220-10085242 CTGCCTTCAAGGCAGGAAGAAGG - Intergenic
1170156939 20:13277708-13277730 GTGCCTACAAGACTGGAGTAAGG + Intronic
1170182976 20:13554079-13554101 CTGCATTCAAAGTGAGAGTAAGG - Intronic
1170261772 20:14416603-14416625 CTTCCTACAATGCTGAAGTATGG - Intronic
1170493624 20:16902901-16902923 CTGTCTTCCAGGCTGGAGTGCGG - Intergenic
1170535980 20:17341201-17341223 CTGCCTTCCAGGCTGGAGTACGG - Intronic
1172414371 20:34752217-34752239 CTGCCTTCATAGTTGGAGCATGG - Intronic
1172706660 20:36887169-36887191 CTGCTTCCAAAGCTGGAGGGAGG - Intronic
1173804883 20:45918041-45918063 CTGCCTATTAAGCTGGAGTGCGG + Intergenic
1173941510 20:46914926-46914948 CTGCCTTCAAAGCTGGAGTATGG + Intronic
1174213267 20:48896772-48896794 CTGTCTCCCAAGCTGGAGTGTGG - Intergenic
1174778165 20:53364635-53364657 CTTCCTTGAAAGCTGCAGAATGG + Intronic
1174800127 20:53556647-53556669 CTGCTGTCCAAGCTGGAGTGTGG + Intergenic
1175212977 20:57373075-57373097 CTGCCTCCCCAGCTGGAGGAGGG - Intronic
1175578397 20:60079698-60079720 CTCCCTTTAAAGCTGGTGTTGGG + Intergenic
1176427398 21:6557261-6557283 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1177475080 21:21609841-21609863 CTACCTTCTAAGCTTGTGTAAGG - Intergenic
1177703084 21:24663625-24663647 CTGCCTCCCAGGCTGGAGTGCGG + Intergenic
1178073131 21:28991252-28991274 CTGTCTCCAAACCTGGAGTGTGG - Intronic
1179169462 21:38961804-38961826 CTGCCTTTAAAGATGGACGAAGG - Intergenic
1179181824 21:39051769-39051791 CTGCCTGCAGAGCTGGAATCAGG + Intergenic
1179702889 21:43165578-43165600 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1179823452 21:43950821-43950843 CTGCGTTTAAAGCGGGAGGAAGG + Intronic
1182091111 22:27595562-27595584 CTGCCTTAAAAGCTGCACTTTGG + Intergenic
1182109814 22:27715195-27715217 CTGCCTTCCCAGCTGGACGAGGG - Intergenic
1182940856 22:34275804-34275826 CTTCCTTTAAAACTGGTGTAAGG - Intergenic
1183579892 22:38717819-38717841 CAGCTTTCACAGCAGGAGTAAGG + Intronic
1183695916 22:39422083-39422105 CTGGGTTCAAAGCTGGGGGAAGG + Intronic
1184226782 22:43133354-43133376 CTGCCTTTAAAGCTTGCGTCAGG + Exonic
1184708998 22:46236917-46236939 CTGCCTTCCCAGCTGGACTGAGG - Exonic
1184772008 22:46602791-46602813 CTGTCTTCCAGGCTGGAGTGCGG + Intronic
1185357056 22:50379834-50379856 CTGCCACCCAGGCTGGAGTATGG - Intronic
949727495 3:7066658-7066680 CTGGCTTCATAGCTGAATTAGGG - Intronic
950003772 3:9678067-9678089 CTGCCCTCAATGCTTGAGTCAGG - Intronic
950167598 3:10813594-10813616 CTGCATTCCAATCTGGACTATGG - Intergenic
952625191 3:35394438-35394460 CTGCCCACAAAGCAGGAGCAAGG + Intergenic
953298718 3:41750192-41750214 CTGCCTTTAATGATGGAGTCTGG + Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955285580 3:57638095-57638117 CTGTCTTCCAGGCTGGAGTACGG - Intronic
955287646 3:57658489-57658511 CTGTCTCCCAGGCTGGAGTACGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
955913968 3:63887620-63887642 CTGCCACCCAGGCTGGAGTATGG + Intronic
956594277 3:70949050-70949072 CTGTCTCCCAGGCTGGAGTAGGG - Intergenic
956687752 3:71846872-71846894 CTGCCGCCCAGGCTGGAGTACGG + Intergenic
956800783 3:72756303-72756325 CTGCCTTCCAGTCTGGAGTGTGG + Intronic
958616187 3:96495692-96495714 CTGCCTCCATAGATTGAGTATGG - Intergenic
959634546 3:108549410-108549432 CCTTCTTCAAAGCTGCAGTACGG + Intergenic
960037386 3:113115531-113115553 CTGTCTTCCAGGCTGGAGTGTGG - Intergenic
960201599 3:114843314-114843336 TTGCCTTCAAATCTGGACTCAGG - Intronic
961401711 3:126651275-126651297 CTGCCTTCCAAGCAGAAGCAAGG + Intronic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
961596518 3:128022239-128022261 CTGCCTGCAGAGCTGGACTGAGG - Intergenic
962825535 3:139096853-139096875 CTGCCTCCAAAGGAGGAGTGTGG - Intronic
965365483 3:167793714-167793736 CTGCCACCTAAGCTGGAGTGCGG - Intronic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
966589580 3:181666848-181666870 CTGTCTTCCAGGCTGGAGTGTGG + Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
968028949 3:195466423-195466445 CTGGCTTCGAAGATGGAGCAAGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969091705 4:4698817-4698839 CTAGCTTGAGAGCTGGAGTAAGG + Intergenic
970317897 4:14846907-14846929 CTGCCGCCCAAGCTGGAGTGCGG + Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
970599996 4:17634358-17634380 CTGTCACCCAAGCTGGAGTACGG + Intronic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972548608 4:40106583-40106605 CTGTCTCCCAGGCTGGAGTACGG + Intronic
974008411 4:56584211-56584233 CTGCCTTGAAAGGTGGAGGTGGG - Intronic
974037665 4:56831136-56831158 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
974446130 4:61984528-61984550 CTGTCATCCAGGCTGGAGTAAGG - Intronic
975334642 4:73161911-73161933 CTGTCACCCAAGCTGGAGTACGG + Intronic
975514949 4:75236727-75236749 CTGCTTCCAGAGCTGGAGCAAGG + Intergenic
976366619 4:84240152-84240174 CTGTTTCCAAAACTGGAGTAAGG + Intergenic
976537557 4:86236058-86236080 CTGGCTTTGAAGGTGGAGTAAGG - Intronic
977124612 4:93149668-93149690 CTGTCACCAAAGCTGGAGTATGG + Intronic
977350471 4:95878782-95878804 CTGCTTCCAAAGCTGGGGCAGGG + Intergenic
977644979 4:99402152-99402174 CTGCCTTCAAACCAGGAAGAGGG - Intergenic
978448274 4:108801873-108801895 CTGCAATCAAAACTGGAGTTTGG + Intergenic
979673716 4:123387852-123387874 CTGTCATCCAAGCTGGAGTGTGG - Intergenic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980020527 4:127704448-127704470 CTGCCACCTAGGCTGGAGTACGG + Intronic
980078068 4:128314866-128314888 CTGCATTCTGAGCTGGAGGAGGG - Intergenic
982150603 4:152451745-152451767 CTGTCGTCCAAGCTGGAGTGCGG - Intronic
982301249 4:153881364-153881386 CTGCTTTCACAGCTGGTGTGAGG - Intergenic
984266958 4:177507047-177507069 ATGCCTTTAGAGCAGGAGTAGGG + Intergenic
984942009 4:184941125-184941147 CTGTCTCCCAGGCTGGAGTAGGG + Intergenic
987631922 5:20484503-20484525 CTGCCTTCAAATCTTGGCTATGG - Intronic
987860148 5:23475233-23475255 CTGCCACCCAGGCTGGAGTATGG - Intergenic
988064164 5:26213770-26213792 CTGGTTTCAAAGCTGAAGCACGG + Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989101237 5:37825386-37825408 CTGACTTAAAAGCTGAAGAATGG - Intronic
989597846 5:43173390-43173412 CTGCATGCCAAACTGGAGTAGGG + Exonic
989621496 5:43388866-43388888 CTGCATTCAAAGTTGAAATAAGG + Intronic
990087469 5:51996338-51996360 CTGCATCCAAAGATGCAGTATGG + Intergenic
992270220 5:75055449-75055471 CTGTCTCCCAGGCTGGAGTAAGG + Intergenic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
993804274 5:92384829-92384851 CTGGCTTGGAAGCTGGAGGAAGG - Intergenic
993891354 5:93478438-93478460 CTGTCATCCAGGCTGGAGTACGG + Intergenic
994381180 5:99073604-99073626 CTGTCATCCAGGCTGGAGTATGG + Intergenic
994711568 5:103271251-103271273 CTGTTTTCAAAGCTGGTCTAAGG + Intronic
995084975 5:108097750-108097772 CTGTCTTCCAGTCTGGAGTACGG - Intronic
995802529 5:116013743-116013765 CTGACCGCAAATCTGGAGTAGGG + Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996105341 5:119495705-119495727 CTGTCTCCCAGGCTGGAGTATGG + Intronic
996624755 5:125557312-125557334 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
996681835 5:126236189-126236211 CTGCCATCCGGGCTGGAGTATGG - Intergenic
998057931 5:139095298-139095320 CTGTCTCCCAGGCTGGAGTACGG + Intronic
998208952 5:140179221-140179243 CTGTCTTCCAGGCTGGAGTGCGG - Intronic
998239011 5:140426164-140426186 CTGCCGCCCAGGCTGGAGTACGG + Intronic
998452008 5:142241945-142241967 CTGTCACCCAAGCTGGAGTATGG + Intergenic
999005582 5:147973776-147973798 CTGCCTTTGAAGCTGGAGAAAGG - Intergenic
999895899 5:156033038-156033060 CTGTCTCCCAGGCTGGAGTATGG - Intronic
1001047052 5:168382054-168382076 CTACATTCAATGCTGCAGTAAGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1002317770 5:178355019-178355041 CTGTCTCCCAGGCTGGAGTACGG - Intronic
1002910447 6:1487327-1487349 CTGCATTCAGTGCTGGAGTCGGG + Intergenic
1003258073 6:4491117-4491139 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
1003930275 6:10918159-10918181 CTGTCGTCCAGGCTGGAGTAAGG - Intronic
1004102749 6:12631404-12631426 CTGTCTCCCAAGCTGGAGTGTGG + Intergenic
1004872639 6:19922736-19922758 CTGCATCCAAGGCTGGAGTTAGG + Intergenic
1005344259 6:24873908-24873930 CTGTCATCCAGGCTGGAGTATGG + Intronic
1005488115 6:26320364-26320386 CAGCCTTCTAAGATGGAGGAAGG + Intergenic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1010197432 6:73253867-73253889 CTGCCACCCAAGCTGGAGTGCGG - Intronic
1013489134 6:110628172-110628194 CTGTCGCCCAAGCTGGAGTACGG - Intronic
1013658051 6:112265865-112265887 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG + Intergenic
1015007791 6:128304788-128304810 CTGTCTTCCTAGCTGGACTAGGG - Intronic
1015496109 6:133885076-133885098 CTGCTTTCAAAGCTGTATTGTGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016821688 6:148352558-148352580 CTGTCTCCCAGGCTGGAGTACGG - Intronic
1017717492 6:157222863-157222885 CTGCCCTCACAGCTGGGGTCTGG - Intergenic
1018116558 6:160591621-160591643 CAGCTTTCAGACCTGGAGTATGG + Intronic
1018490600 6:164288516-164288538 CTGTCACCCAAGCTGGAGTATGG - Intergenic
1018592200 6:165438919-165438941 CTGTCACCCAAGCTGGAGTACGG - Intronic
1018955372 6:168406522-168406544 CTGCATTTAATGCTGGAGTTTGG - Intergenic
1021107659 7:16656994-16657016 CTGACTCCAAGGCTGGAGCAGGG - Intronic
1021788390 7:24175377-24175399 CTGTCTCCCAGGCTGGAGTATGG - Intergenic
1022010016 7:26300632-26300654 CTGCCTTCAGAGATGGAGGCTGG - Intronic
1022119938 7:27298451-27298473 CTGTCACCCAAGCTGGAGTACGG + Intergenic
1022488115 7:30795804-30795826 CTGGCTTCAAAGGTGAAGGAAGG - Intronic
1024556628 7:50608926-50608948 CTGCCTCCCAGGCTGGAGTACGG - Intronic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026650645 7:72213259-72213281 CTGGCCTCAAAGCTGGAGACAGG + Intronic
1026668719 7:72367586-72367608 CTGCCATCCAGGCTGGAGTGTGG - Intronic
1027203863 7:76081497-76081519 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
1027356481 7:77361055-77361077 CTGCCTTCAATGCTGGTTTTTGG - Intronic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1029103776 7:98157213-98157235 CTGTCATCCAAGCTAGAGTACGG - Intronic
1029676298 7:102071412-102071434 TTGCCTTAGAATCTGGAGTAAGG + Intronic
1029687706 7:102160140-102160162 CTGTCATCCAAGCTGGAGTATGG - Intronic
1029734592 7:102458530-102458552 CTGTCTCCCAAGCTGGAGTACGG - Intronic
1031346728 7:120675892-120675914 CTGTCTCCCAGGCTGGAGTACGG + Intronic
1031557697 7:123198586-123198608 CTACCTGCAAAGCTGGAGAAGGG - Intronic
1034137874 7:148788037-148788059 CTGCCTACAAAGCAGGAAGAGGG - Intronic
1034231622 7:149533855-149533877 CTGCCTTCAATAATTGAGTAAGG + Intergenic
1036035802 8:5017781-5017803 CTGTTTTCCAGGCTGGAGTACGG + Intergenic
1036130378 8:6104199-6104221 CTGTCTCCCAAGCTGGAGTGCGG - Intergenic
1036369858 8:8153727-8153749 CTGCCTTCCAACCTGGACGATGG - Intergenic
1036450881 8:8866353-8866375 CTGTCCTCTAGGCTGGAGTACGG + Intronic
1036881033 8:12511903-12511925 CTGCCTTCCAACCTGGACGATGG + Intergenic
1037431011 8:18813193-18813215 CTGACTTAAAAGCTGGTGGAAGG + Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038048248 8:23785368-23785390 CTGCCTAAAAAGCAGGAGTATGG - Intergenic
1038459789 8:27706186-27706208 CTGTCACCAAAGCTGGAGTGCGG + Intergenic
1041589255 8:59557874-59557896 CTGCATTCAAAGTCGGAGCAGGG - Intergenic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1042869263 8:73382639-73382661 ATTCCTTCAAAGCTGGAGTAGGG + Intergenic
1043841919 8:85116408-85116430 CTGTCATCCAGGCTGGAGTATGG + Intronic
1044827308 8:96210645-96210667 CTGTCTCCCAGGCTGGAGTACGG - Intergenic
1046234656 8:111407124-111407146 CTGTCATCCAAGCTGGAGTGCGG - Intergenic
1049521575 8:143094179-143094201 CTTCCTTCAAAACAGGAGGAAGG - Intergenic
1049965341 9:774514-774536 CTGTCGTCCCAGCTGGAGTACGG + Intergenic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1051776117 9:20635992-20636014 CCTCCTTCAAAGCAGGGGTATGG - Intergenic
1051925823 9:22323559-22323581 CTGCCTTTGAAGGTGGAGGAAGG - Intergenic
1052294135 9:26878776-26878798 CTGTCCCCCAAGCTGGAGTACGG - Intronic
1053359051 9:37470250-37470272 CTGTCATCCAAGCTGGAGTACGG + Intergenic
1056556721 9:87695543-87695565 CAGCCTTCACAGCTCCAGTATGG + Intronic
1056695923 9:88852545-88852567 CTGCCACCCCAGCTGGAGTATGG - Intergenic
1057806338 9:98222434-98222456 ATGCCTGCAAAGCTGGTGGAAGG + Intronic
1058698882 9:107584764-107584786 CTGCCTCCACATCTGGAGTCAGG - Intergenic
1058897972 9:109416372-109416394 CTGCCGCCAAAGCTGAAGAAGGG + Intronic
1058929740 9:109707373-109707395 CTGACTTCAAAGCTGGGGCAGGG - Intronic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186621912 X:11250621-11250643 CCGGCTTCAAAGATGGAGAAAGG - Intronic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1189223279 X:39391205-39391227 CTGCCTTCCAACTTGGATTATGG - Intergenic
1192178780 X:68902566-68902588 CTGGCTTCAAACCTAGAGTTGGG + Intergenic
1194556536 X:95367595-95367617 CTGCCACCCAGGCTGGAGTACGG + Intergenic
1196440657 X:115717063-115717085 CTGTTGTCCAAGCTGGAGTATGG + Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1198595088 X:138227655-138227677 CTACCTACAGAGCTGGATTAAGG + Intergenic
1198829292 X:140731558-140731580 CTGCCTTCGAGGCTGTTGTAAGG + Intergenic
1198922014 X:141739722-141739744 CTGCCTTCTAAGTTGTAGTCAGG - Intergenic
1200062859 X:153491353-153491375 CTGTCTTCAAAGCTACAGCAGGG - Intronic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic