ID: 1173941541

View in Genome Browser
Species Human (GRCh38)
Location 20:46915094-46915116
Sequence GAGGCTGATGTGGCTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173941541_1173941546 17 Left 1173941541 20:46915094-46915116 CCCAAAGGAGCCACATCAGCCTC 0: 1
1: 0
2: 0
3: 32
4: 212
Right 1173941546 20:46915134-46915156 TTCGAGCTGTTGCCTGTGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 129
1173941541_1173941545 13 Left 1173941541 20:46915094-46915116 CCCAAAGGAGCCACATCAGCCTC 0: 1
1: 0
2: 0
3: 32
4: 212
Right 1173941545 20:46915130-46915152 TAGCTTCGAGCTGTTGCCTGTGG 0: 1
1: 0
2: 0
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173941541 Original CRISPR GAGGCTGATGTGGCTCCTTT GGG (reversed) Intronic
900837196 1:5014075-5014097 GAGGCAGAGGCAGCTCCTTTTGG - Intergenic
901311212 1:8270872-8270894 GACGTTAATGTGGCTCATTTTGG + Intergenic
902333889 1:15744036-15744058 GAAGCCGATGTGGCCCCTTCGGG + Intronic
904702638 1:32366929-32366951 GAGGCTGACTTGGTTCCTGTAGG - Intronic
910480089 1:87649344-87649366 GAGGCTGATGAGGCTTCACTTGG - Intergenic
911384326 1:97156008-97156030 GATGCTGATGTTGCTGGTTTGGG + Intronic
913179839 1:116310998-116311020 GAGGCAGAAGTGGGTCCATTTGG + Intergenic
913712051 1:121494869-121494891 GAGGCTGCAGTGGCTGCTTTGGG + Intergenic
915090139 1:153418546-153418568 GATGTTGATGTGGGGCCTTTGGG - Intronic
915095354 1:153458547-153458569 GATGTTGATGTGGGGCCTTTGGG + Intronic
917070254 1:171142597-171142619 GATGCTGATGTGGCTGGTTTAGG - Intronic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917924801 1:179780541-179780563 GATGCTGATGTTGCTCATCTGGG - Intronic
918220607 1:182432864-182432886 GAGGATGATGTGGTTAATTTTGG - Intergenic
919657832 1:200214568-200214590 AAAGCAGATGTGGCTCCTTTGGG - Intergenic
919756209 1:201067644-201067666 GAGGATAAAGTGGCCCCTTTGGG - Intronic
921874301 1:220176834-220176856 GAGGCTGGTGTGTCTCATGTTGG - Intronic
922988210 1:229883056-229883078 CTGGCTGATGTGGCCCCTATGGG + Intergenic
1062837476 10:645235-645257 GAGGCTGTTTTGGCTGCTTCTGG - Intronic
1065603726 10:27394553-27394575 GGGGATGCTGTGGCTCCCTTGGG - Intergenic
1066038570 10:31520988-31521010 GAGGCTGAGTAGGCTGCTTTAGG - Exonic
1066662931 10:37754219-37754241 GATGCTGGTTGGGCTCCTTTTGG + Intergenic
1066994240 10:42549252-42549274 AAGGGTGATGTGTTTCCTTTTGG + Intergenic
1067011810 10:42721219-42721241 GATGCTGATGTTGCTGCTCTGGG - Intergenic
1067049166 10:43002081-43002103 GGGGGTGATGAGGCTCCCTTAGG + Intergenic
1067157815 10:43796980-43797002 GAGGCTGAGGTCTCTCCTTTGGG + Intergenic
1067432039 10:46251329-46251351 GATGCAGGTGTGGCTCCATTTGG - Intergenic
1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG + Intronic
1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG + Intergenic
1070435793 10:76391347-76391369 GAAGCTGATGAGGCTTATTTTGG + Intronic
1070771185 10:79083195-79083217 GTGGGTGATGGGGCTTCTTTAGG + Intronic
1073916986 10:108417105-108417127 TAGGCTGGTGTGAATCCTTTGGG - Intergenic
1074430574 10:113390729-113390751 GCGGCTGATGTGTCTCTTTGAGG + Intergenic
1075871637 10:125775493-125775515 GTGGCTCCTGTGGCTCCTATTGG - Intronic
1076561110 10:131364880-131364902 GAGGCAGGTGCGGCTCCCTTTGG + Intergenic
1076624828 10:131815337-131815359 GGGGCAGATGAGGCTCATTTGGG + Intergenic
1077545988 11:3170217-3170239 GAGGCTGAGGTGGCTCCAGGGGG + Intergenic
1078339517 11:10488841-10488863 GGGGAGGATGTGGCTCCTCTGGG + Intronic
1078387243 11:10903456-10903478 GAAGGTGATTTGGCTCCTTGAGG + Intergenic
1079081287 11:17415223-17415245 CAGGGTGATGTGGCTCCCTTGGG + Intronic
1080114484 11:28606812-28606834 GAGGCTGCTCTGGTGCCTTTGGG + Intergenic
1080629989 11:34065526-34065548 GATGCTGATGTTGCTGGTTTGGG + Intronic
1083703650 11:64498326-64498348 GGGGCTGATGTGGTGCCTCTTGG - Intergenic
1084588113 11:70074975-70074997 GAGGCTGAAGTGTCTCCCTTTGG - Intergenic
1085217892 11:74848426-74848448 GAGGCTGCTTCGGCACCTTTGGG + Exonic
1085874622 11:80391356-80391378 GAGGCTTATATGTTTCCTTTGGG - Intergenic
1090185036 11:124732632-124732654 GATGCTGAGGTGGCCTCTTTTGG - Intergenic
1091911034 12:4230863-4230885 GAGGCTGATGTGGATATTCTCGG - Intergenic
1092193704 12:6536836-6536858 TAGGATGGTGTGGCTCCCTTGGG + Intronic
1092448578 12:8581334-8581356 CAGGCTGATTTGGCTCCTCTGGG + Intergenic
1092705610 12:11281159-11281181 CAGGCAGATGTGCCTCCTTGTGG + Intergenic
1092714473 12:11374634-11374656 CAGGCAGATGTGACTCCTTGTGG + Intronic
1092718185 12:11413668-11413690 CAGGCAGATGTGACTCCTTGTGG + Intronic
1094568576 12:31622120-31622142 GAGGATATTGTGGCTGCTTTTGG - Intergenic
1095953672 12:47795056-47795078 GAGGGGGATGTGGCTTCTTGGGG - Intronic
1098140215 12:67443352-67443374 GATGCTGATGTGGCTCTAGTCGG + Intergenic
1098305860 12:69102000-69102022 CAGTCTGATTTGGCTCCTTCTGG + Intergenic
1098904784 12:76150789-76150811 GAGGCTGAAGTAGCTCCATTAGG + Intergenic
1100048071 12:90410241-90410263 GATGCTGATGGTGCTGCTTTGGG - Intergenic
1101955882 12:109212223-109212245 GAGGCTGTGGTGGGTCCTTTAGG + Intronic
1102762268 12:115398472-115398494 GGGGGTGATCTGGCTCCTTCTGG - Intergenic
1102819523 12:115895936-115895958 GGAGCTGAAGTGGCTCCTTTGGG - Intergenic
1103210073 12:119159160-119159182 GGGACTGATGTGCCTCCTTCTGG - Exonic
1106017281 13:25881767-25881789 GAGGCTGATGTTGCTGCCTTGGG - Intronic
1107446250 13:40472514-40472536 GAGGCTGATGTTGCAGATTTTGG - Intergenic
1107974961 13:45679952-45679974 GAGGCTGGGGTGGGTGCTTTGGG + Intergenic
1112782843 13:102920534-102920556 TTGGCTGATGAGGCTTCTTTTGG - Intergenic
1113371136 13:109726455-109726477 GAGGCTGCTGCTGCTGCTTTGGG - Intergenic
1117606199 14:57431388-57431410 GTGGCTGATGTGGTACCTTAAGG - Intergenic
1119654830 14:76409744-76409766 CAAGCTGAGGGGGCTCCTTTGGG + Intronic
1120633030 14:86914432-86914454 GAGGAAGATTGGGCTCCTTTGGG + Intronic
1122285865 14:100652173-100652195 ATGGCTGACGTGGCTCCTCTGGG - Intergenic
1122940589 14:104979263-104979285 GAGGCTGAGGGGGCTCCTGTCGG + Intergenic
1123755932 15:23397726-23397748 GAGGCTGATGCTGCTCCACTGGG - Intergenic
1124620280 15:31270071-31270093 AAGGATGATGTGGCAGCTTTCGG + Intergenic
1124628219 15:31322351-31322373 GTGGCTCATGTGGTTCCTCTTGG - Intergenic
1125391771 15:39200194-39200216 GAGGCTGGTGTGGTTCCTGCAGG - Intergenic
1126101772 15:45122221-45122243 GAGGCTGTTCTGGCTGCTTCGGG - Exonic
1127335519 15:57979789-57979811 GTGGCTGACGGGGCTCCCTTGGG - Intronic
1127764980 15:62176625-62176647 GGGGCTGGTGTTGCTTCTTTTGG - Intergenic
1129146003 15:73648050-73648072 GAGGCTGAGGTGGAACCTGTGGG - Intergenic
1130134230 15:81168564-81168586 GAGTCAGATGTGGCTCCTCATGG - Intronic
1131268384 15:90932181-90932203 GAGCCAGATGTGGCCCCTTGTGG + Intronic
1131432264 15:92396242-92396264 CAGGCTGATGTAGCTGCCTTAGG + Intronic
1131517230 15:93087772-93087794 GAAGGTGATGGAGCTCCTTTAGG + Intronic
1134136082 16:11677204-11677226 GAGCCTGTGGTGGCTACTTTTGG + Exonic
1134656985 16:15954633-15954655 GTGGCTGCAGTGGCTCCATTTGG - Intronic
1135233075 16:20727851-20727873 GATGCTGATGTTGCTGGTTTGGG - Intronic
1138584123 16:57959745-57959767 GAAGCTGATGTGGCTGCCTTGGG + Intronic
1139661449 16:68423850-68423872 GAGGCTGATGTGGGTGGTTCTGG + Intronic
1140647422 16:77048213-77048235 GAGGCTAATGTTGCTCTTTATGG + Intergenic
1141171274 16:81693271-81693293 GAGGCAGTGGTGGCTCCTCTTGG + Intronic
1141406657 16:83800494-83800516 ATGGCAGATGTCGCTCCTTTGGG + Intronic
1142545830 17:702091-702113 GAGGCTTATGTCTGTCCTTTGGG + Intronic
1144382582 17:14717433-14717455 GAGACTGAGGTGGCTACTGTTGG + Intergenic
1146816307 17:35944809-35944831 GAGGCTCATGTGACTTCCTTGGG - Intergenic
1148954880 17:51345426-51345448 GAGTCTCATGTGACTTCTTTTGG + Intergenic
1151264922 17:72947447-72947469 GATGGTGATGGGGCTGCTTTGGG - Intronic
1151348233 17:73516318-73516340 GAGGCTGCTGTGGCCCTGTTCGG + Intronic
1152364682 17:79848772-79848794 AAGGCAGATGTGGCTCCCCTGGG - Intergenic
1152477463 17:80527353-80527375 GAGGCTGAGGGGGCTCTTTTGGG + Intergenic
1152699427 17:81811769-81811791 GAGGCTGAAGAAGCTCCTCTCGG - Exonic
1156676608 18:39534250-39534272 GAGGCCTATGAGGTTCCTTTGGG - Intergenic
1158509873 18:58080863-58080885 GAGCTTGATGGGGCTGCTTTAGG - Intronic
1161979509 19:7623379-7623401 GAGGGTGCTGTGGCCCCTGTCGG + Intronic
1162473405 19:10885852-10885874 GTGGCTGCTGTGGCTCCCTGTGG - Intronic
1162588647 19:11576943-11576965 GAAGGTGATGGGGCACCTTTGGG - Intronic
1163544881 19:17935323-17935345 GATGGTGATGTGGCCTCTTTTGG + Intronic
1164795515 19:31024087-31024109 GAGGCTGAGGTGCCTGGTTTGGG - Intergenic
1168020410 19:53605101-53605123 CAGGCTGATGTGGAACCTCTGGG - Intergenic
925014798 2:514579-514601 GAACCTGGTGTGGCTCCTTGAGG + Intergenic
925274128 2:2636922-2636944 GAGGCTGCTGGGCCTCCTCTGGG - Intergenic
927431562 2:23030618-23030640 CAGGCTGAAGTGGCTCTTTAGGG - Intergenic
927655903 2:24946306-24946328 GAGGCAAGTGTGGATCCTTTGGG - Exonic
927708383 2:25310900-25310922 GATGCTGAAGTTGCTCATTTGGG + Intronic
927784173 2:25961024-25961046 GGGGCTGTGGTGACTCCTTTAGG + Intronic
931839155 2:66130321-66130343 GAAGCTGATGATGCTCTTTTGGG - Intergenic
931911402 2:66903851-66903873 GAGGCTGATGCAGGTGCTTTGGG + Intergenic
933371940 2:81425467-81425489 CAAGCTGATGTGGCTTTTTTGGG + Intergenic
936480330 2:112879713-112879735 GAGGCTGATCTGGCTCTGTGAGG + Intergenic
936892856 2:117392593-117392615 GTGGCTGCTGTGGCTCCATTTGG + Intergenic
937878367 2:126844728-126844750 AAGGCTGATTTGGTTACTTTAGG - Intergenic
938240805 2:129741202-129741224 GTGGGTGATGTGCCTCCTCTGGG - Intergenic
939883588 2:147657247-147657269 GAGCCAGATGTGGCTGCTCTTGG - Intergenic
940169618 2:150813752-150813774 GAAGCTGATGTGGCTGATGTTGG - Intergenic
945989199 2:216379615-216379637 GAGACTGATGTGGCACATTAGGG + Intergenic
946245339 2:218384147-218384169 GAGCCTGTTGGGGCTCCTCTAGG + Intronic
948997754 2:241592369-241592391 GAGGCTCGTGTGACTCTTTTTGG - Intronic
1169878701 20:10324317-10324339 CAGGGTGATGTGGCTCCCTTTGG - Intergenic
1170630383 20:18059475-18059497 GAGGCTGATGGGGCAGCTTCCGG + Intergenic
1170875668 20:20247746-20247768 GAGGCTGGTGTGGCTCAAATGGG - Intronic
1173941541 20:46915094-46915116 GAGGCTGATGTGGCTCCTTTGGG - Intronic
1174624115 20:51900127-51900149 GAGGCTGAGGTGACTCCCATAGG - Intergenic
1176080518 20:63270519-63270541 GAGGCTGCTGTGGATGCTGTGGG + Intronic
1178297194 21:31420283-31420305 GAGGCTGATGTGGCTGTCCTGGG - Intronic
1178473417 21:32915952-32915974 GAGGCTGCTGGGGCTCCACTGGG - Intergenic
1179461217 21:41536570-41536592 GAGGCTGATGCAGCTCCGATGGG - Intergenic
1182918141 22:34054361-34054383 AAGGCTGAGCTGGCTCCTTGAGG + Intergenic
1184681782 22:46076079-46076101 GTGGCTGGTGTGGCTGCTCTGGG - Intronic
1185363072 22:50420757-50420779 GACACTGATGTGGCCCTTTTGGG - Intronic
949400429 3:3659908-3659930 GAAGCTAATGTGGCTCTTTAAGG - Intergenic
950447322 3:13045778-13045800 GAGGCTGAGGAGGCTCCTGTAGG - Intronic
953931145 3:47006326-47006348 GAGTTGGATGTGGCTCCTGTGGG - Exonic
954440079 3:50516956-50516978 GAGGCTGAGCTGGCTCCTGGAGG - Intergenic
955172694 3:56582700-56582722 GAGTTTGATGTGGATCCTTCTGG + Intronic
956106235 3:65821694-65821716 GATGATGATGTTGCTTCTTTTGG - Intronic
958919012 3:100082050-100082072 GAGGCTCATGTAGCACTTTTTGG - Intronic
960297085 3:115957503-115957525 GAGGATCATGTGGTTCCATTAGG - Intronic
961737038 3:129008843-129008865 GAGGCTGATGTGGCTGCGAGGGG - Intronic
962873296 3:139516867-139516889 GAGGCTGCTCTGTCTCTTTTAGG + Intergenic
966256747 3:177925656-177925678 GTGGCTGAGCTGGCTACTTTAGG + Intergenic
967216822 3:187218297-187218319 CAGGCTGTGGTGGCTCCTGTGGG - Intronic
968843785 4:3028158-3028180 GAGGCTGCTGGGGATCCTGTAGG + Intronic
968971451 4:3797860-3797882 GCGGGTGAAGTGGCTCCTCTGGG - Intergenic
970132809 4:12889917-12889939 GTGGCTGAAGTGTCTCCTTGAGG + Intergenic
970894320 4:21084758-21084780 GGGGCTGAAGTGGCTATTTTAGG - Intronic
970989059 4:22191741-22191763 GAGGCTGAGGTGAGTGCTTTTGG - Intergenic
974684984 4:65215924-65215946 GTGGCTGATGTGGCCCCTCTTGG - Intergenic
979312339 4:119217890-119217912 GAGGCTGATGTGGCTGGAATGGG + Intronic
979356990 4:119715950-119715972 GTGGCTGCTGTGGCTGCTGTGGG - Intergenic
979698311 4:123639241-123639263 GAGACAGATGTGGGTCATTTTGG + Intergenic
980181049 4:129401111-129401133 GGATCTGATGTGGCTCCTTCTGG + Intergenic
981277679 4:142920923-142920945 GATGCTGATGTTGCTCATTCTGG - Intergenic
981670351 4:147279514-147279536 GATGCAGTGGTGGCTCCTTTGGG - Intergenic
982269319 4:153570435-153570457 GAGGCTAATCTGGGTACTTTGGG + Intronic
983408706 4:167368079-167368101 GAAGCTAATGTTTCTCCTTTGGG - Intergenic
986383570 5:7209152-7209174 GAAGCTGAGGGGGCTCCTCTGGG - Intergenic
989965591 5:50462854-50462876 GAGGCTGCAGTGGCTGCTTTGGG - Intergenic
992068218 5:73126444-73126466 GAGGCTGCTGTGGCTCATGAAGG + Intronic
992168631 5:74079752-74079774 AAGACTGATGTGGCTTATTTGGG + Intergenic
992370355 5:76137449-76137471 GAGGCTGATGAAGTTCATTTTGG + Intronic
994514193 5:100749982-100750004 GAAGCTGATTTGCCCCCTTTAGG + Intergenic
994717352 5:103337490-103337512 GAGGATGAAGTGCCCCCTTTTGG + Intergenic
995707030 5:114997014-114997036 GAGGCTGGTCTGGCTGCTCTTGG - Intergenic
995851052 5:116545986-116546008 GAGGCTAAGGTGGTTCATTTTGG + Intronic
1000370527 5:160531495-160531517 GATGCTGATGTTGCTCTTCTTGG + Intergenic
1000828495 5:166075060-166075082 CAGGCTGTTGTTGCTCATTTTGG + Intergenic
1002305476 5:178280261-178280283 GAGGCTGAAGGCGCCCCTTTTGG - Intronic
1003989190 6:11469083-11469105 GATGCTGATGTTGCTGCTTCTGG + Intergenic
1004045011 6:12014669-12014691 GAGCCTGAGGTGGCTGATTTGGG + Intronic
1006294949 6:33166172-33166194 GTGGCTCCTTTGGCTCCTTTGGG + Exonic
1006668787 6:35716837-35716859 AAGGTTGATGTGGCAGCTTTGGG - Intronic
1007159491 6:39777503-39777525 GTGGCTGTTGTGGCCCCTGTAGG + Intergenic
1007402933 6:41614825-41614847 GAGGCTCAGGTGGCTCCTAACGG + Intergenic
1007524475 6:42480017-42480039 GATGCTAATGTGGCTCCTGGTGG - Intergenic
1007785902 6:44279192-44279214 GGGGCTGATGTGATTCCTGTAGG + Exonic
1008208098 6:48687241-48687263 GAGGCAGAGGTGGCTGCTTAGGG - Intergenic
1009489592 6:64272647-64272669 TAGTCTGATGTGCTTCCTTTAGG + Intronic
1010000415 6:70943377-70943399 GTGGCTGAGATGGCTCCTTCTGG - Intronic
1010172058 6:72986487-72986509 GAGGGGGATGTGGCTCTTATAGG - Intronic
1011224692 6:85093663-85093685 GAGGCTGATCTGGCTGATCTTGG - Intergenic
1011748635 6:90433504-90433526 CAGGCTGGTGTGGCTTCTTGTGG - Intergenic
1014307275 6:119758183-119758205 GAGGCTGAGGTGTCTCCTGAGGG - Intergenic
1016021317 6:139239048-139239070 AAGACTGATTTTGCTCCTTTTGG - Intergenic
1019344845 7:524437-524459 GAGGCTCATTTTGCTCCTCTGGG + Intergenic
1019975629 7:4579131-4579153 GATACTGCTGTGGCTGCTTTTGG - Intergenic
1020738289 7:11980763-11980785 TTGGCTGTTGTGGCTCTTTTTGG - Intergenic
1020803421 7:12759826-12759848 GAGAATGATGTGTCTCCTGTTGG + Intergenic
1020849609 7:13334924-13334946 CAGGCTCACGTGGCTTCTTTAGG + Intergenic
1023841770 7:44102163-44102185 CAGGCTGATGTGCCTCCCTTTGG - Intergenic
1024011573 7:45271369-45271391 GAGGGTGACTTGGGTCCTTTGGG - Intergenic
1025036558 7:55596899-55596921 GATGCTGATGTGGTTTCTTAGGG - Intergenic
1025164170 7:56696003-56696025 GAGGCTGATGGGACCCCTTTTGG - Intergenic
1025706112 7:63866068-63866090 GAGGCTGATGGGACCCCTTTTGG + Intergenic
1028260887 7:88663305-88663327 GAGGCTGTTGTAGATTCTTTGGG + Intergenic
1029000379 7:97148125-97148147 GAGGCTGAGGTGGATCACTTGGG - Intronic
1030455420 7:109766845-109766867 GGGGCTGCTGTGGCTTCCTTGGG - Intergenic
1030469517 7:109946072-109946094 CAGCCTGATGGTGCTCCTTTGGG - Intergenic
1033040024 7:137909296-137909318 GAGGGTGTTGTGCCTCCTTGAGG - Intronic
1033645344 7:143298152-143298174 GATGCTGCTGTTGCTGCTTTAGG + Intronic
1034558853 7:151866970-151866992 GAGGCTGGTGTGGCAGCTCTGGG - Intronic
1035282005 7:157784491-157784513 GAGGCTGAGGTGGTTCCTGCAGG - Intronic
1035437454 7:158869493-158869515 GAGTCTGTTGTGGCTGTTTTTGG + Intronic
1035967165 8:4205654-4205676 ACGGCTGTTGTGGCTCATTTGGG + Intronic
1036495339 8:9265334-9265356 GATGCTGAACTGGCTCCTTTGGG + Intergenic
1039271185 8:35882558-35882580 CAGGCTGATTTGGTTCCTTTGGG - Intergenic
1040396217 8:47002941-47002963 AAGGCTGATTTGACTCATTTGGG - Intergenic
1042319993 8:67464980-67465002 GTGGCTAATCAGGCTCCTTTTGG + Intronic
1044004874 8:86927890-86927912 GAGGCTGGTCTGGCTGATTTTGG + Intronic
1046628542 8:116600952-116600974 GAGGCTGCTGTGGCACTTTGAGG - Intergenic
1048531469 8:135253944-135253966 GAGGCTGAGGTGAGTACTTTTGG - Intergenic
1049100649 8:140576656-140576678 GAGGCTGATGCAACTGCTTTGGG + Intronic
1049172898 8:141173043-141173065 GAGGCGGAGGTGGCTGCATTGGG + Intronic
1049214934 8:141403143-141403165 GAGGCTGATGGGGCTCATCCTGG - Intronic
1049595573 8:143481810-143481832 GAGGCTGATGAGGCCCCTCATGG - Intronic
1049607472 8:143536390-143536412 GAGGCTGAGGTGGCTCTTGGCGG + Exonic
1051188234 9:14482696-14482718 GAGGCTGTTGTGGTTCATTTGGG - Intergenic
1052461258 9:28766582-28766604 GATGCTGATTTCACTCCTTTGGG - Intergenic
1052716017 9:32118431-32118453 GATGATGGTGTGGCTCCTTAGGG - Intergenic
1055483109 9:76729352-76729374 GATGCTGATGTGGCTGGTCTGGG + Intronic
1057205987 9:93173057-93173079 GAGAATGATGCGGCCCCTTTGGG + Intergenic
1057986311 9:99718121-99718143 GAGGCTGATGAGGCATGTTTTGG - Intergenic
1062253238 9:135608692-135608714 CAGCCTGGTGTGGCCCCTTTTGG - Intergenic
1186402155 X:9269872-9269894 GATGCTGATGTTGCTCATCTGGG + Intergenic
1187493085 X:19771087-19771109 GAGTCTGATGTGGCACACTTTGG + Intronic
1187657447 X:21493431-21493453 GAGGTTGCTTTGGCTCCTGTTGG + Intronic
1188887564 X:35569117-35569139 GGTGCTGATGTGGCTCCTTCAGG + Intergenic
1190326890 X:49212057-49212079 CAGGGTTATGAGGCTCCTTTAGG - Intronic
1198957491 X:142148655-142148677 GAGGAGGATGTGGCTACTTCTGG - Intergenic
1199188035 X:144939583-144939605 GAGGCTGAGGTGGATGCTTAGGG - Intergenic
1199934028 X:152553699-152553721 GTTGCTGATGTCTCTCCTTTGGG - Intergenic
1200184878 X:154175705-154175727 GAGGCTGATGTGGAACCTCTTGG + Intergenic
1200190531 X:154212843-154212865 GAGGCTGATGTGGAACCTCTTGG + Intergenic
1200196282 X:154250645-154250667 GAGGCTGATGTGGAACCTCTTGG + Intergenic
1200201937 X:154287763-154287785 GAGGCTGATGTGGAACCTCTTGG + Exonic