ID: 1173943960

View in Genome Browser
Species Human (GRCh38)
Location 20:46935167-46935189
Sequence TTGCTATGTAGAGTGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173943953_1173943960 9 Left 1173943953 20:46935135-46935157 CCCCTGCATCAGCTCTACTCAGG 0: 1
1: 0
2: 0
3: 7
4: 175
Right 1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 133
1173943957_1173943960 7 Left 1173943957 20:46935137-46935159 CCTGCATCAGCTCTACTCAGGGC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 133
1173943955_1173943960 8 Left 1173943955 20:46935136-46935158 CCCTGCATCAGCTCTACTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173943960 Original CRISPR TTGCTATGTAGAGTGAGTGC AGG Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
907173027 1:52489009-52489031 TTACTTTGTAGAGTGAGTGCAGG - Exonic
907702953 1:56807017-56807039 TTGCAATGCTGAGTGAGTGTGGG - Intronic
908723089 1:67147181-67147203 TTGCAAGCAAGAGTGAGTGCTGG + Intronic
909048723 1:70742509-70742531 TGGCTTTGTAGAATGAGTTCAGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911237661 1:95428941-95428963 TTGCCACGTAGAGTTAGTACTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
919284855 1:195543796-195543818 TTCCTTAGTAAAGTGAGTGCAGG - Intergenic
920414167 1:205787282-205787304 TTGCTTTGAAGAGTTAGTACTGG + Intergenic
1062801186 10:381758-381780 CTGGAGTGTAGAGTGAGTGCAGG - Intronic
1065911865 10:30314068-30314090 TTGCTATGTAAAGTTAATGCTGG - Intronic
1066294618 10:34043406-34043428 TTGTGATGTAGAATGAGTGAAGG + Intergenic
1068965822 10:62911337-62911359 TAGTTCTGTAGAGTGAGTGAAGG - Intronic
1071243897 10:83741500-83741522 TTGCTATGGAGAGAGACTGGTGG - Intergenic
1073566554 10:104540268-104540290 TTGTTTTGTGGAGTGACTGCAGG + Intergenic
1074553326 10:114465660-114465682 TTGTTATATAGAGTGAATCCAGG + Intronic
1078203675 11:9208942-9208964 TTACTTTGTACAGTAAGTGCAGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081152464 11:39648677-39648699 TAGCTATGAAGCCTGAGTGCTGG - Intergenic
1081167179 11:39820781-39820803 TTGCTATGCAAAGTGACTGGAGG - Intergenic
1081684309 11:45030901-45030923 TTGCTGTGAAGAATCAGTGCAGG - Intergenic
1081815585 11:45938466-45938488 TAGCTATGTGGAGTGAGTAGGGG - Intronic
1082612592 11:55319551-55319573 TTTATATGTAGAGTGAGAGTGGG + Intergenic
1091345265 11:134848191-134848213 TTGCCATTTAGAGGAAGTGCAGG + Intergenic
1092830473 12:12439716-12439738 TTGCTCAGTACTGTGAGTGCTGG - Intronic
1093078103 12:14777815-14777837 TTTCTATGTAAAGTGAGTAGCGG + Intronic
1093555202 12:20464702-20464724 TTTCCTTGAAGAGTGAGTGCAGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095896502 12:47285412-47285434 TTGCTAAGTAGAGAGGGTGGTGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097146313 12:56941861-56941883 TTGCTATGGAGAGTGTGTGGGGG - Intergenic
1097148415 12:56957874-56957896 TTGCCATGGAGAGTGTGTGTGGG - Exonic
1097534590 12:60850844-60850866 TTCCTATATAGAATGAGTTCAGG - Intergenic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1100100938 12:91104820-91104842 TTGCTATGGTGTGTGATTGCTGG - Intronic
1103496382 12:121365601-121365623 TTGAAATGTAGAGTCATTGCTGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108183236 13:47863008-47863030 TTGTTATGTATAGTGAGAGATGG - Intergenic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108729859 13:53223836-53223858 TTGTTATGTTGAGTGTGTGGGGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109651441 13:65332335-65332357 GTGATATGTAGAGTGAGGGATGG + Intergenic
1113057285 13:106282397-106282419 TTGAAATGTTCAGTGAGTGCCGG - Intergenic
1114787792 14:25621090-25621112 TTGATATGAAGAGTGATAGCTGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122469160 14:101954507-101954529 TTTCTAAGTAGAGTGAGTAGGGG - Intergenic
1125680322 15:41526547-41526569 TTGCTATAAAGAGGGAGGGCTGG - Intronic
1127632087 15:60836927-60836949 TTGCTATGTAGAAGCATTGCTGG - Intronic
1131031619 15:89190884-89190906 TTGATATGATGAGTTAGTGCAGG + Intronic
1131880949 15:96861349-96861371 TTGCTAGGAAGTGTGAGTGCTGG + Intergenic
1131957431 15:97751253-97751275 ATGCTATGTAAACTGAGTGCGGG + Intergenic
1139727917 16:68916822-68916844 AGGCTATGTTGTGTGAGTGCAGG - Intronic
1140678811 16:77363396-77363418 TTGATATGCTGAGTGATTGCTGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1149145353 17:53484601-53484623 AAGCTTTGTAGAGTAAGTGCTGG - Intergenic
1149462913 17:56847728-56847750 TTGCTTTGTAAAGTCAGTGTGGG + Intronic
1153904249 18:9646958-9646980 TGGCTATGGAGAGGGAGGGCTGG + Intergenic
1155189370 18:23415859-23415881 TTGCTATGTAGAGCCAATACTGG + Intronic
1156111005 18:33727213-33727235 TTGCTGAGAACAGTGAGTGCTGG - Intronic
1157504766 18:48218514-48218536 GTGCCATGTAGAGAGAGGGCTGG - Intronic
1159138228 18:64361820-64361842 TTGCTATGCAGAGAGACTGGTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164229388 19:23274316-23274338 TTGGTATGGAGAGAGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
926847584 2:17159483-17159505 TTGCAGTGCAGAGTGGGTGCTGG + Intergenic
927331521 2:21869952-21869974 TTGTTATGAAGAGAGAGTGAGGG + Intergenic
930679902 2:54246025-54246047 TTTTTATGTAGAGTGAGAGATGG + Intronic
931510303 2:62984402-62984424 ATGCTATGTACTGTGTGTGCAGG - Intronic
933344568 2:81066590-81066612 TTGCTATGTAAAGAGACTGGAGG - Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
937616734 2:123932328-123932350 TGGCTTTGTAGAGTGAGTTGGGG + Intergenic
937800533 2:126076429-126076451 TTGCTATGCAAAGAGACTGCTGG + Intergenic
940571563 2:155442654-155442676 TTATTATGTAGAGTGAGATCTGG - Intergenic
944405326 2:199377572-199377594 TTGGAATATAGAATGAGTGCAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168954531 20:1825860-1825882 TAGCTTTGTAGAGGGAGGGCAGG + Intergenic
1173594458 20:44249628-44249650 TTCCTATGTAGCGTGAGCTCAGG + Intronic
1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG + Intronic
1174200294 20:48802354-48802376 TGGCTGGGTAGAGTGAGTGAGGG - Intronic
1177442106 21:21139075-21139097 TTGATATGTAGAGAGAATCCCGG + Intronic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1183151297 22:36039771-36039793 TTGCTATGCAGAGAGACTGGTGG - Intergenic
1185114312 22:48922778-48922800 TAGATATGTTCAGTGAGTGCTGG - Intergenic
950607924 3:14100684-14100706 TGGCTTTGTAGAATGAGTGAAGG - Intergenic
951558031 3:23940463-23940485 TTGCATTGTAGTGTGTGTGCTGG + Intronic
952006778 3:28850275-28850297 TTGCTATGTAGTGAGGGTGGAGG + Intergenic
952607368 3:35165449-35165471 TGGCTATGGAGAGTGAGTGAAGG + Intergenic
954347723 3:50014211-50014233 ATGCTGTGTAGTGAGAGTGCAGG + Intronic
958078150 3:88710885-88710907 TGGCTCTGTATATTGAGTGCAGG - Intergenic
961934003 3:130563967-130563989 TTGCTATGTAGTTTTAGTACTGG + Intronic
964149154 3:153503179-153503201 TAGCTAAGTAGAGTGAGAGAAGG + Intergenic
966056494 3:175698519-175698541 TTCCTATGTACATAGAGTGCAGG + Intronic
969068786 4:4513740-4513762 TTGCTGTCAAGATTGAGTGCTGG - Intronic
969125051 4:4941057-4941079 TTTCTATGCAGAGTTATTGCTGG + Intergenic
972272338 4:37523344-37523366 TTGCTATGGGGAGTGAGAGAAGG + Intronic
974496348 4:62633511-62633533 TGGCTTTGTAGAGTGAGTTAGGG - Intergenic
976457948 4:85271375-85271397 TTGCTTTGTAGAGTGAGTTAAGG - Intergenic
977014138 4:91670961-91670983 TTGCTATGCAAAGAGACTGCCGG - Intergenic
982161816 4:152578072-152578094 TTCCTATGTAGAGAGAGAGAGGG - Intergenic
985717342 5:1470017-1470039 TTGCTATGGAGAGGGTGTGCTGG + Intronic
987369746 5:17182059-17182081 TTTCTTTGTTGAGTGAGTGAAGG - Intronic
994859977 5:105179335-105179357 TTGCTAAGTTGAGTGAGTTTAGG - Intergenic
995446329 5:112248209-112248231 TTGCCATGTAGAGTAACTGCTGG + Intronic
999426437 5:151491194-151491216 TTGCTAGGAAGAGTGTGAGCTGG + Exonic
1000825988 5:166044313-166044335 TTGCTCTGTAGAATGAATTCAGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006318496 6:33304978-33305000 TTGCTGTGTACAGTGAGTTGGGG - Exonic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1015405811 6:132835786-132835808 TTGCTAAGTAAAGTGAGGGAGGG - Intergenic
1017391975 6:153950125-153950147 TTGCTGTGTAGTGTGAGTAATGG - Intergenic
1021142106 7:17039263-17039285 TTGCAATATAGATTGAGAGCTGG - Intergenic
1021152254 7:17165961-17165983 TTGCTATGTAGGGGGTGGGCAGG + Intergenic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1022997805 7:35775724-35775746 TTTTTATGTAAAGTGAGGGCTGG + Intergenic
1023828573 7:44025978-44026000 TTGCTGTGTACAGTGAGATCAGG + Intergenic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1029756869 7:102579421-102579443 TTGCTGTGTACAGTGAGATCAGG + Intronic
1029774808 7:102678481-102678503 TTGCTGTGTACAGTGAGATCAGG + Intergenic
1032593748 7:133218157-133218179 TGGCTATGTGGAGTGAATTCTGG + Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1035104196 7:156428604-156428626 TTGCTCTGCAGAATGAGCGCTGG - Intergenic
1035632067 8:1115713-1115735 TGGCTATGTAGAGTTACAGCTGG + Intergenic
1036119784 8:6003309-6003331 CTGCTAGGTAGAGGGAGTGGGGG - Intergenic
1039357721 8:36839661-36839683 TTGCTATGGAGAGTTATGGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043278622 8:78434602-78434624 TTGCCATGAAGAGAGATTGCAGG + Intergenic
1048943174 8:139420225-139420247 GTGCTAAGTAGAGAGAGTGAAGG - Intergenic
1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG + Intergenic
1059069576 9:111121032-111121054 TTGCTATGCAAAGAGAGTGGTGG - Intergenic
1060267466 9:122120869-122120891 TTGCCATGTGCAGTGGGTGCTGG - Intergenic
1060418163 9:123447607-123447629 TTGCTATGCAGAGTTAGAGGAGG + Intronic
1060806786 9:126582761-126582783 TTGATATCTACAGTGTGTGCAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190278689 X:48915337-48915359 CTGCTATGGAAAGTGGGTGCAGG - Exonic
1190797946 X:53761227-53761249 CTGCCATGTATAGTGACTGCAGG - Intergenic
1190917213 X:54819983-54820005 CTGCCATGTATAGTGACTGCAGG + Intergenic
1193023361 X:76817045-76817067 TTGTTATGTAGTGTGAGTTAAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193827093 X:86240161-86240183 TTGGAAGGTAGAGTGAGTCCTGG + Intronic
1193946345 X:87740692-87740714 TTACTCTTTATAGTGAGTGCCGG + Intergenic
1197451946 X:126629806-126629828 TTGCTATGCAGAGTGACTGGTGG - Intergenic
1199749889 X:150805536-150805558 ATGCTAAGTTGTGTGAGTGCTGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1202189099 Y:22222686-22222708 TTCCTATGTAGGATGAGTTCAGG + Intergenic