ID: 1173944722

View in Genome Browser
Species Human (GRCh38)
Location 20:46941379-46941401
Sequence TCTTCTGCTCCTCAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173944717_1173944722 14 Left 1173944717 20:46941342-46941364 CCGGAAGTAGAACGAAACTCCTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1173944722 20:46941379-46941401 TCTTCTGCTCCTCAGCTGTGTGG 0: 1
1: 0
2: 2
3: 45
4: 314
1173944716_1173944722 17 Left 1173944716 20:46941339-46941361 CCACCGGAAGTAGAACGAAACTC 0: 1
1: 0
2: 0
3: 1
4: 68
Right 1173944722 20:46941379-46941401 TCTTCTGCTCCTCAGCTGTGTGG 0: 1
1: 0
2: 2
3: 45
4: 314
1173944719_1173944722 -5 Left 1173944719 20:46941361-46941383 CCTAAGTCGATTCCCGGCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1173944722 20:46941379-46941401 TCTTCTGCTCCTCAGCTGTGTGG 0: 1
1: 0
2: 2
3: 45
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173944722 Original CRISPR TCTTCTGCTCCTCAGCTGTG TGG Intronic
900919788 1:5662845-5662867 ACCTCTGCCCCACAGCTGTGAGG - Intergenic
902166132 1:14573038-14573060 ACTCATGCTCCTCAGCTCTGAGG + Intergenic
902663349 1:17920722-17920744 TCTGCTACTCCTTAGCTGCGTGG - Intergenic
903759282 1:25686615-25686637 TTTTCACCTCCTGAGCTGTGGGG + Intronic
904093350 1:27960028-27960050 TCTCCTGCTCCTCCGCGGTTGGG - Exonic
905507674 1:38493106-38493128 TTTTCTGCTCCTGCTCTGTGGGG - Intergenic
908107634 1:60861499-60861521 CCTTCTGCTCCTGTGCTGTGAGG - Intergenic
908726818 1:67185234-67185256 TCTCCTTCTCTGCAGCTGTGTGG - Intronic
909476886 1:76090885-76090907 TATTCTACTCCTCAGCTCAGTGG - Intronic
911205525 1:95088458-95088480 TCTTATCCTCCTCTGCAGTGAGG + Intergenic
912118583 1:106439452-106439474 TCATCAGCTCCTCTGCTTTGCGG - Intergenic
912193649 1:107371823-107371845 TCTTCTGGTCCTAAGCTTTTTGG - Intronic
915785507 1:158607122-158607144 TCTTCTGCCCCTCAGCAGAGGGG - Exonic
915933537 1:160076200-160076222 TCTCCTCCTCCTCTGCTCTGAGG - Intergenic
917135358 1:171783967-171783989 TCTTCTCTTCCTCATCTGTCAGG - Exonic
918256339 1:182752094-182752116 TCTTATGTTTCTCAGCTGTGGGG - Intergenic
918294555 1:183144077-183144099 ACTTTTGATCCTCAGCTCTGTGG + Exonic
920298540 1:204974635-204974657 TGTTCTGCTGCTCTGTTGTGAGG + Exonic
920457265 1:206110590-206110612 TCATCTGTTCCTCATCTGTGGGG - Intronic
920535232 1:206732812-206732834 TCCTCTCCTCCTCAGCTGCATGG + Exonic
920878011 1:209855305-209855327 CCTTCCCCTCCTCAGATGTGGGG + Exonic
920973002 1:210758502-210758524 TCTCTTGCTCCTCAGCTGGTAGG - Intronic
921292690 1:213673226-213673248 TCTTCTACTTCCCAGCTGTCAGG + Intergenic
921566450 1:216727421-216727443 TCTACTCCTCATGAGCTGTGTGG + Intronic
921570614 1:216774081-216774103 TCTTCCACTCCTAAGCTATGTGG - Intronic
922825281 1:228513368-228513390 TCTCCTGCTCCCCAGCCCTGGGG - Intergenic
923435441 1:233963708-233963730 TCTTCAGCCTCTCAGATGTGGGG + Intronic
923446673 1:234077717-234077739 TAGCCTGCACCTCAGCTGTGGGG + Intronic
923640152 1:235749162-235749184 TCTTCTGTTTCTGAGCAGTGTGG - Intronic
924907743 1:248474160-248474182 TCATGTCCTGCTCAGCTGTGTGG - Exonic
924916365 1:248573926-248573948 TCATGTCCTGCTCAGCTGTGTGG + Exonic
1062925906 10:1315167-1315189 TCTTCTTCCCCTCAGCGGGGTGG + Intronic
1063086465 10:2822606-2822628 CCTTCTGCTCCTGTGCTCTGTGG + Intergenic
1063157779 10:3396144-3396166 TCTTCTGCTCTTTAGCTGTCAGG + Intergenic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1064504609 10:16015065-16015087 TCTTTTGCTCCTTCTCTGTGGGG - Intergenic
1065482682 10:26211630-26211652 CCCTCTGCTCCTCAGCTTAGAGG + Intronic
1065563934 10:26990279-26990301 ACTTATGTTCCACAGCTGTGTGG + Intergenic
1065902339 10:30220024-30220046 TGTGCTCCTCCCCAGCTGTGGGG - Intergenic
1065975746 10:30840801-30840823 TCCTCCCCTCCCCAGCTGTGCGG - Intronic
1067218939 10:44327701-44327723 TCTACTGCTCCACTGCTGTTGGG + Intergenic
1067302604 10:45026101-45026123 TCCTCTGCTCCTGTGCTGTGTGG - Intergenic
1068870716 10:61941080-61941102 TCTGCTGCTTCTTAGCTGTATGG + Intronic
1070802426 10:79251453-79251475 CCTCCTGCTCCCCAGCTTTGGGG + Intronic
1071023380 10:81083842-81083864 TCGTCTGCTCCTCAGCATCGTGG + Intergenic
1071600511 10:86956585-86956607 GATCCTGCTCCTTAGCTGTGTGG + Intronic
1072619917 10:97073195-97073217 TCTTCTGCCCCTGGTCTGTGTGG + Intronic
1072747305 10:97949724-97949746 TCTGCAACTCTTCAGCTGTGTGG + Intronic
1075289510 10:121216255-121216277 TCTTGTGCTCCTCAGAACTGAGG - Intergenic
1075713647 10:124543619-124543641 TCTTGCACTTCTCAGCTGTGTGG + Intronic
1076706088 10:132302395-132302417 TCTTCTCCTTCCCAGCTGTGAGG - Intronic
1076783043 10:132735018-132735040 TTGTCTGCTCCCCAGCCGTGTGG + Intronic
1077563727 11:3282819-3282841 TCTTCTGCTCTTTAGCTGTCAGG - Intergenic
1077569617 11:3328636-3328658 TCTTCTGCTCTTTAGCTGTCAGG - Intergenic
1077865637 11:6218996-6219018 CCTCCTGAACCTCAGCTGTGAGG - Exonic
1080075706 11:28145607-28145629 TCTTTTGCTCCTCATTTCTGTGG + Intronic
1080868353 11:36214748-36214770 TCTTCTTTTTCTCACCTGTGAGG + Intronic
1081534845 11:43989184-43989206 TCTGCCGCTCATCAGCTGTGTGG + Intergenic
1081594093 11:44447216-44447238 CTGACTGCTCCTCAGCTGTGTGG - Intergenic
1081638843 11:44739174-44739196 ACTTCTGCACCTAGGCTGTGAGG + Intronic
1081934508 11:46895661-46895683 TCTGCTACTCGCCAGCTGTGTGG + Intronic
1082263803 11:50098335-50098357 TCTGCTGCTCACCTGCTGTGTGG + Intergenic
1085470396 11:76753896-76753918 TCACCTGCCTCTCAGCTGTGTGG + Intergenic
1085921193 11:80959216-80959238 TTTTCTGCTTCTCAGCTCTCAGG - Intergenic
1086455620 11:86956096-86956118 TCTGCAGCTCCGCAGCTCTGGGG - Intergenic
1087142306 11:94776652-94776674 GCTGCTGCTTCTCAGCTGTGAGG + Intronic
1088600839 11:111473321-111473343 TCTTCTGCTCTTCACCAGTATGG + Intronic
1088712951 11:112524783-112524805 TCTTCAGTTCCTCAGGAGTGTGG + Intergenic
1089272817 11:117314002-117314024 TTTTCCTCTTCTCAGCTGTGTGG - Intronic
1089637144 11:119822331-119822353 ACTTCTGCTCCTCCACTCTGGGG - Intergenic
1090767100 11:129885519-129885541 ACTCCCGCTCCTCAGGTGTGCGG + Exonic
1091379087 12:44308-44330 TCATCTGGGGCTCAGCTGTGTGG - Intergenic
1091836802 12:3591976-3591998 TCTTCTGATCCCCAGCACTGAGG + Intronic
1092404726 12:8211536-8211558 TCAACTCCTCCTCAGCTCTGAGG - Intergenic
1092596368 12:10009666-10009688 GCATCTGCTTCACAGCTGTGGGG + Intronic
1092637752 12:10469622-10469644 CCATCTGCTCCTCAGCACTGTGG + Intergenic
1093659585 12:21738546-21738568 TCTTCTGCCTCTCAGCTTTGTGG + Intronic
1094734761 12:33222520-33222542 CCACCTGCCCCTCAGCTGTGTGG - Intergenic
1095840657 12:46688017-46688039 TCCTCTTCTCCCCAGCTGAGAGG + Intergenic
1096103582 12:48983868-48983890 CCTTCTGATCCTCCCCTGTGGGG - Intergenic
1096272568 12:50177860-50177882 TCTTCTACCCCTGGGCTGTGAGG + Exonic
1101815093 12:108140161-108140183 TCTGCTGCTTCTCAGCTGAGTGG + Intronic
1102685293 12:114719853-114719875 TCTTCTGCTCCTGATCTGGTTGG + Intergenic
1103846104 12:123902931-123902953 TCTTCTTCTCCTCGGCTGCAGGG - Exonic
1104371753 12:128229593-128229615 TCTGCTGCTTATCATCTGTGTGG - Intergenic
1104426201 12:128680304-128680326 TCTGCTACTAATCAGCTGTGCGG - Intronic
1104650536 12:130528808-130528830 TTTTGACCTCCTCAGCTGTGTGG - Intronic
1104954200 12:132456536-132456558 TCATCAGCTGCTCAGCTGGGCGG - Intergenic
1105962679 13:25356223-25356245 TCTTCAGCTCCTCAGCACTGAGG + Intergenic
1106506972 13:30379096-30379118 TCTTATGCTCCTCTGCTATAAGG - Intergenic
1107164782 13:37271441-37271463 TCTTCTGGTCCTCAGGTCTGTGG + Intergenic
1109308208 13:60663289-60663311 CCTTCTGCTTCTCAGCACTGTGG - Intergenic
1112537631 13:100275376-100275398 CCTGCTGCTCCCCAGCCGTGGGG + Intronic
1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG + Intergenic
1114722101 14:24893404-24893426 TGTTCTGCAACTTAGCTGTGTGG - Intronic
1118985385 14:70750074-70750096 TCTTCCTCTCCTTAGCTATGGGG - Exonic
1119206060 14:72794368-72794390 TCTGCTTCTGCTCATCTGTGTGG - Intronic
1121016974 14:90554812-90554834 GCTCCTTCTCTTCAGCTGTGTGG - Intronic
1121637560 14:95463998-95464020 ACTGCTGCTTCCCAGCTGTGTGG - Intronic
1121641181 14:95485895-95485917 TCTGCTGGTCCTCAGGGGTGAGG - Intergenic
1121660646 14:95632657-95632679 AGTTCTCCTCCCCAGCTGTGGGG - Intergenic
1122038491 14:98965221-98965243 GCTGCTGCTGCTCAGCTCTGTGG + Intergenic
1122234046 14:100322225-100322247 TCTGTTGCTCAGCAGCTGTGTGG + Intergenic
1122692304 14:103537163-103537185 CCTTCTGCTCCTCTGCTATGGGG - Intergenic
1122946678 14:105014185-105014207 CCTTCTGCTCCTGGGCTGTGGGG + Intronic
1123440103 15:20284424-20284446 TCTGCTACTACTTAGCTGTGTGG + Intergenic
1123762782 15:23445636-23445658 TCTTCTGATTCTGAGCTCTGGGG + Intronic
1123856767 15:24420315-24420337 TTTTCAGCCACTCAGCTGTGTGG + Intergenic
1123861320 15:24470212-24470234 TTTTCAGCCACTCAGCTGTGTGG + Intergenic
1125281803 15:38049706-38049728 TATTCTTCTCCTGAGCTTTGTGG - Intergenic
1125530524 15:40410420-40410442 GCTGGTGCTCCTCAGCTGAGGGG - Intronic
1126697789 15:51340869-51340891 TCTGTTGCTACTCAGCTGGGAGG - Intergenic
1127146441 15:56029405-56029427 TCTGCTGCTGCTCAGCTGTTTGG - Intergenic
1127967238 15:63931556-63931578 CCTCCTGCTCCTCAGGTGGGAGG - Intronic
1128231607 15:66039332-66039354 TCCCCTCCTCCTCAGCTGTCAGG - Intronic
1128512016 15:68319198-68319220 TCTGCGGCTCACCAGCTGTGTGG + Intronic
1130126210 15:81096200-81096222 GCTGCTGTTCCTCAGGTGTGTGG + Intronic
1131060016 15:89398900-89398922 TCCACTGCTTCCCAGCTGTGTGG - Intergenic
1131352524 15:91714341-91714363 ACTTCTGCTCTCCAGCTGTTTGG - Intergenic
1131384347 15:91990898-91990920 TCTACTGCTCCTCAACACTGAGG - Intronic
1132871932 16:2119224-2119246 CCTCTTGCTGCTCAGCTGTGGGG - Intronic
1134095103 16:11413892-11413914 TCTGCTGCTTGCCAGCTGTGTGG - Intronic
1134520594 16:14917672-14917694 CCTCTTGCTGCTCAGCTGTGGGG + Intronic
1134550980 16:15138302-15138324 CCTCTTGCTGCTCAGCTGTGGGG - Intronic
1134708266 16:16316323-16316345 CCTCTTGCTGCTCAGCTGTGGGG + Intergenic
1134715481 16:16356356-16356378 CCTCTTGCTGCTCAGCTGTGGGG + Intergenic
1134951336 16:18352322-18352344 CCTCTTGCTGCTCAGCTGTGGGG - Intergenic
1134959276 16:18395803-18395825 CCTCTTGCTGCTCAGCTGTGGGG - Intergenic
1136845069 16:33570011-33570033 TCTGCTACTACTTAGCTGTGTGG - Intergenic
1137904652 16:52308817-52308839 TGTTCTGCATCTCAGCTGTGAGG - Intergenic
1138308397 16:56001299-56001321 TCTTCTGCTTTTTATCTGTGTGG - Intergenic
1138891640 16:61150340-61150362 TCATCTTCTCCTCAGCACTGTGG + Intergenic
1139961738 16:70721916-70721938 TCCTGTGCTCCTGTGCTGTGGGG - Intronic
1140145247 16:72300486-72300508 TCTGCTGCTTGTCAGCAGTGGGG + Intergenic
1141460948 16:84178629-84178651 TCCGCTGCGCCTCAGCTGTGGGG - Exonic
1141479318 16:84295754-84295776 TCTGCTGCTCATTAGCTGCGTGG + Intronic
1141889105 16:86914827-86914849 TGTTCTCCTCCTCAGCTTGGAGG - Intergenic
1141947413 16:87320140-87320162 GCTTCTGCTGCTCAGGTGTCAGG - Intronic
1203106777 16_KI270728v1_random:1418664-1418686 TCTGCTACTACTTAGCTGTGTGG - Intergenic
1203155237 16_KI270728v1_random:1870309-1870331 TCTGCTACTACTTAGCTGTGTGG - Intergenic
1142468544 17:149054-149076 TCCTCTGCCCCACAGCAGTGGGG - Intronic
1142933968 17:3311679-3311701 TCTTCCTCCCCTCAGCTGAGCGG - Intergenic
1143019373 17:3908833-3908855 CCTGCTGCTCCCCAGCTGTGTGG + Intronic
1143367848 17:6420135-6420157 TCTCCAGCTCCTCAGGGGTGTGG - Intronic
1144888950 17:18483073-18483095 TCTGCTGCTCCTGACCTGAGTGG - Intronic
1145143258 17:20461223-20461245 TCTGCTGCTCCTGACCTGAGTGG + Intronic
1146130729 17:30272620-30272642 TCTTCTGTTTCTAGGCTGTGTGG - Exonic
1147848059 17:43419236-43419258 TCTGCTGCCCCTCAGCTCTGAGG - Intergenic
1148968163 17:51455384-51455406 TCTGCTCTTCCTCATCTGTGTGG - Intergenic
1149605210 17:57919706-57919728 TCTGCTACTTCTTAGCTGTGTGG + Intronic
1149642620 17:58213750-58213772 TCTTCCTCTCCTCACCTGTAGGG + Exonic
1150833048 17:68540951-68540973 TCTTCTCCCCCTCAGGTGGGAGG - Exonic
1150845950 17:68658057-68658079 TCTTGTCCTCATCAGCTCTGTGG - Intergenic
1150869897 17:68895758-68895780 TCTTCTGCAACGCAGATGTGGGG - Intronic
1152203254 17:78959386-78959408 TCTTGAGCTCCTAACCTGTGGGG - Intergenic
1152676638 17:81644788-81644810 CCTTCTGCTGCTCAGCCGAGCGG + Intronic
1152739161 17:82011525-82011547 TCTTTTTCTCCTCTGCAGTGGGG + Exonic
1152768527 17:82153800-82153822 ACATCTCCTCCTCACCTGTGGGG - Intronic
1152927814 17:83095621-83095643 TCGTCTTCTCCTCAGCTGGGGGG + Intergenic
1153073326 18:1131930-1131952 TCCTATCCTCCTCAGCTCTGTGG - Intergenic
1153855564 18:9142310-9142332 TGTTCTGCTACTGAGCTGTGAGG - Intronic
1158890404 18:61866801-61866823 TCATGTGCTGCTCAGCGGTGGGG - Intronic
1160050630 18:75430054-75430076 TCCACTGCTCCTCTGCTGCGTGG - Intergenic
1162496106 19:11024171-11024193 CCCTCTTCTCCCCAGCTGTGAGG + Intronic
1163190407 19:15673081-15673103 TCTTCTCCTCTTCTGCTGGGAGG - Exonic
1163755401 19:19103697-19103719 CCCTCTGCCCCTCAGCTGTTTGG + Intronic
1164577420 19:29413737-29413759 GCTTCTGGCCCTCAGCTGTGGGG + Intergenic
1164958453 19:32406139-32406161 GCTTCTGCTCGTCGGCCGTGCGG + Exonic
1165935523 19:39386389-39386411 TCTCCTGCTCCTCATCTGGAAGG + Exonic
1166344947 19:42159628-42159650 TCTCCTGCTGCTCACCTCTGTGG - Intronic
1166573873 19:43818444-43818466 CCTTCTTCTCCTCAGCTAGGTGG - Intronic
1167556911 19:50202572-50202594 TCGGCTGCTCAGCAGCTGTGTGG - Intronic
1167568470 19:50271890-50271912 TCTCCTCCTCCTCAGCTGCCTGG - Exonic
1168308507 19:55449685-55449707 TCTCCTCCTCCACAGCTGAGGGG + Intergenic
1168310900 19:55460112-55460134 ACTTCTGCTCCTTTGCTCTGGGG - Intronic
1168611224 19:57802222-57802244 TTTTTTTTTCCTCAGCTGTGTGG + Intronic
924962112 2:45246-45268 CCTTCTGCTCTTCAGCAGCGGGG + Intronic
926520964 2:13912738-13912760 GCTCCTTCTCCTCAGCTTTGGGG + Intergenic
926654912 2:15391591-15391613 TCTTCTGCTCCTCTCCTTTCAGG - Intronic
927493033 2:23533001-23533023 CCTTCTGCTCCTCAGCTTGGGGG - Intronic
927648828 2:24898651-24898673 GCTTCTGCTCCTTTGCTTTGTGG - Intronic
928872913 2:36002142-36002164 TCTTCTGCTGCTAACCTCTGGGG - Intergenic
929834899 2:45386383-45386405 TCTCCAGCCCATCAGCTGTGTGG - Intergenic
929873521 2:45777499-45777521 TCTGTTGCTCATCAGCTGAGGGG - Intronic
930252112 2:49046079-49046101 GCTTCATCTCCTCACCTGTGAGG + Intronic
930956813 2:57212764-57212786 TCCCCTGCTTCACAGCTGTGTGG + Intergenic
932133591 2:69209411-69209433 TCCTCTGTTTATCAGCTGTGGGG - Intronic
932462969 2:71895362-71895384 TCCTCAGCTCTTCTGCTGTGAGG - Intergenic
932802394 2:74752497-74752519 CAATCTGCTCTTCAGCTGTGTGG + Intergenic
933402050 2:81810620-81810642 TCTTCTACCCCTCATGTGTGTGG + Intergenic
933686484 2:85145661-85145683 GCTTGTGCTCCTCACCTGTTGGG - Intronic
934048532 2:88191098-88191120 TTTTCTTCTCCTCAGTGGTGTGG + Intergenic
934476519 2:94597171-94597193 GCTTTGGCTCCTGAGCTGTGAGG + Intronic
936281127 2:111140994-111141016 TCCTCTGCTCCTCTAGTGTGAGG + Intronic
936564618 2:113573299-113573321 TCATCTGGGGCTCAGCTGTGTGG + Intergenic
937352599 2:121175669-121175691 TCTCCTGCTCCGCTGCTCTGGGG - Intergenic
937466839 2:122140259-122140281 TCTTCGGCTGGTCAGCTCTGTGG - Intergenic
938760360 2:134420143-134420165 TCTTCTCCTTTCCAGCTGTGGGG + Intronic
938953665 2:136279539-136279561 TCTGCTGCTCCTCAGCTTTCTGG + Intergenic
939146429 2:138420596-138420618 TCTTCTGCTCATCTGCCATGTGG + Intergenic
939666782 2:144962825-144962847 TCTTCTTCTACTCTGCTGTCTGG - Intergenic
942060483 2:172224581-172224603 ACTTCTACTCCTCAGATATGAGG - Intergenic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
942276305 2:174326461-174326483 TCCTCTCCTCCGCAGCTGCGGGG - Intergenic
942345199 2:174995663-174995685 TCTGCTGCTCACCTGCTGTGTGG + Intronic
942866807 2:180686303-180686325 TGTTCTGCTCTTCAGCTGTTTGG - Intergenic
943637358 2:190320528-190320550 TCTTCTGCTACACATCTGGGTGG - Intronic
946696004 2:222359974-222359996 TCTTGTGCTACTCATATGTGGGG - Intergenic
947778013 2:232730212-232730234 TCTGCTGCTCCTCAGCTCTCAGG - Intronic
947873523 2:233453139-233453161 ACTTCTGTTGCTCAGCTGGGTGG + Intronic
948257356 2:236577902-236577924 CCTGCTGCTGCCCAGCTGTGGGG + Intronic
948508100 2:238444573-238444595 TGTTCTGCGCCACGGCTGTGAGG + Exonic
1169907610 20:10619041-10619063 TCTTCAGCCCCTGAGCTGTCAGG - Intronic
1169931083 20:10833761-10833783 TTCTCTTCTCCTCATCTGTGAGG - Intergenic
1172153574 20:32807985-32808007 CCTGCTCTTCCTCAGCTGTGTGG + Exonic
1173601429 20:44298210-44298232 CCTGGTGCTCCTCAGCTGTTGGG + Intergenic
1173944722 20:46941379-46941401 TCTTCTGCTCCTCAGCTGTGTGG + Intronic
1174181710 20:48679305-48679327 TCTACCTCTTCTCAGCTGTGTGG - Intronic
1174283634 20:49456886-49456908 TCTGCTGCTTCCCAGCTGTGTGG - Intronic
1175798820 20:61789205-61789227 GCATCTGCACCTGAGCTGTGTGG + Intronic
1175902416 20:62365365-62365387 TCTCCTCTGCCTCAGCTGTGTGG - Intronic
1176220852 20:63968866-63968888 TCCTCTGCTCCCCAGCTCTCAGG - Intronic
1179355978 21:40660158-40660180 TCTGCTGCTCATTAACTGTGTGG - Intronic
1180231281 21:46428243-46428265 TCTGCTGGGCCTCAGCTCTGGGG - Intronic
1181309771 22:21938291-21938313 GCTGCTGCTCCTCCGCTCTGCGG - Intronic
1181531212 22:23518550-23518572 TCTTCTGCTAATTGGCTGTGTGG + Intergenic
1182213330 22:28694923-28694945 TCTGCTACTACTTAGCTGTGTGG - Intronic
1182833340 22:33321482-33321504 TCTTGTGCTCTTCTGCAGTGTGG - Intronic
1183063032 22:35347109-35347131 TCTCCAGCCCCTCAGCTGAGGGG + Exonic
1183324250 22:37182959-37182981 TCTTCTGCTCCTGCACTGTGTGG - Intronic
1183668216 22:39257138-39257160 TCCTCTGCTGGCCAGCTGTGTGG + Intergenic
1184047484 22:41980553-41980575 TCTGCTACTTCTCAGCTTTGTGG - Intronic
1184763219 22:46557399-46557421 TCTTCTCCTCCCCAGCTCTCAGG + Intergenic
1185136030 22:49073176-49073198 TCTGCTGCTGCTCAGCTCTAGGG + Intergenic
1185177615 22:49337897-49337919 TCTTTTTTTCCTGAGCTGTGTGG + Intergenic
952158749 3:30672104-30672126 TCTTCCGCTCCTCAGCCGTCAGG - Exonic
952417236 3:33100491-33100513 TCTACTGCTCCCCAGCTCTGTGG - Intergenic
953776295 3:45820238-45820260 TCTTTTACTCATCAGCTGTTTGG - Intergenic
956326152 3:68055226-68055248 TCCTCTGCTCCTCAGCCCTTAGG - Intronic
956515929 3:70047836-70047858 TCTTCTGCTCTTCATCCATGTGG - Intergenic
956772365 3:72537359-72537381 TCTGATGCCCTTCAGCTGTGTGG - Intergenic
957424656 3:80022084-80022106 TCTTCTGGTTCTCAGGTGTTTGG - Intergenic
959890722 3:111552298-111552320 TCTTCTGCTCTTCTGCCATGTGG + Intronic
961189202 3:124943324-124943346 TCTGCTGGTGCTCAGCTCTGAGG + Intronic
961431228 3:126884983-126885005 TCTTCTACTCCTCAGTGGAGAGG - Intronic
961477405 3:127157409-127157431 TCTGCTGCCTCTCACCTGTGGGG + Intergenic
963141001 3:141946032-141946054 ACTTCTACCCCTCAGCTGTTTGG + Intergenic
963756853 3:149243391-149243413 TCTTAAGCTGCTCAGCTGAGAGG - Intergenic
964175997 3:153826535-153826557 TCTTCAGCTGCTAAGCTGAGGGG + Intergenic
966919987 3:184604834-184604856 TCTCCTGCTCACCCGCTGTGTGG + Intronic
968966702 4:3772517-3772539 TCCTCTGCTCCTCAGCTCTAGGG - Intergenic
969609155 4:8217297-8217319 TCTGCTGCTTCCCAGCTGTGTGG + Intronic
969933558 4:10658452-10658474 TCTCCTGGTTCTCAGCTGGGGGG + Intronic
970300901 4:14680568-14680590 TCTGCTGCTCTGGAGCTGTGTGG - Intergenic
971158634 4:24109917-24109939 TCTTCTCCACCTCCTCTGTGGGG - Intergenic
971790266 4:31161464-31161486 TCTTCCACTCATTAGCTGTGGGG + Intergenic
971862281 4:32123198-32123220 TATGCTGCTCCTCAATTGTGAGG + Intergenic
972282503 4:37616421-37616443 TTCTCTGCTCCCCACCTGTGTGG + Intronic
978281580 4:107022509-107022531 TCTGCTACTCATGAGCTGTGTGG + Intronic
980180436 4:129394078-129394100 TCCTCTGCACCTCAGCAGCGTGG + Intergenic
982157780 4:152538099-152538121 CCTTCTGTTCCTCAGCACTGAGG - Intergenic
982936238 4:161480318-161480340 TCTTTTGCTTCTCAGCTCAGAGG - Intronic
983926950 4:173412798-173412820 GCTTCTGGTACCCAGCTGTGTGG - Intergenic
984061072 4:174989656-174989678 CCTTCTCCTCATCATCTGTGTGG + Intergenic
985171831 4:187158226-187158248 TCTGCAGCTCCTCAACGGTGTGG + Intergenic
985325730 4:188767658-188767680 TATTCTGCTCCTCTGCCATGTGG - Intergenic
985358576 4:189147436-189147458 TCTGCTTTTCCCCAGCTGTGGGG + Intergenic
985538654 5:477886-477908 TCCTCTGGCACTCAGCTGTGTGG - Intronic
985616034 5:922589-922611 TCTTCTGACCCTCTGCAGTGAGG - Intergenic
986271635 5:6236138-6236160 GTCTCTGCTCCTCACCTGTGAGG + Intergenic
986430125 5:7673510-7673532 GCTTCTGCACCTCAGCACTGTGG + Intronic
988085840 5:26474645-26474667 CCTTATGCTCCTGAGCTGTGTGG - Intergenic
988635662 5:32981391-32981413 TCCTCCTCTCCTCAGCTCTGTGG + Intergenic
989107732 5:37879353-37879375 CCTTCTGCCCCTCTGCTCTGGGG + Intergenic
992097020 5:73372354-73372376 TCTGCTTGTCCTCAGCTGGGTGG + Intergenic
993105869 5:83600224-83600246 TCATCTGCTCCACAGATCTGTGG + Intergenic
994657939 5:102617310-102617332 TCTTTAGCTTCTCAGCTCTGGGG - Intergenic
995707693 5:115002033-115002055 TCCTCTGGTCCTCAGGTCTGCGG + Intergenic
997309209 5:132866187-132866209 CCTCGTGCTCCTCTGCTGTGGGG + Intronic
998834369 5:146189739-146189761 GCTTCTGCTCCTAAGGCGTGTGG + Intergenic
999588263 5:153115380-153115402 TGTTCTGTTCCTCCCCTGTGAGG - Intergenic
999745615 5:154589723-154589745 TCTGCTGCTCCTCATCAGCGAGG + Intergenic
999883936 5:155899038-155899060 TCTTCTGGTCCTCAAATGCGTGG - Intronic
1002340452 5:178513381-178513403 TCTGCTGCTTTCCAGCTGTGTGG - Intronic
1002965675 6:1963952-1963974 TCTGCTGCTCCTAGGCAGTGTGG - Intronic
1003559679 6:7170389-7170411 TCTGCTGCTCCTGGGCAGTGAGG - Intronic
1004143798 6:13046237-13046259 TCTGGTGCTCCTCAGCTGCTTGG - Intronic
1004925540 6:20412149-20412171 TCATCTAGTCCTCAGTTGTGTGG + Intronic
1005823874 6:29620481-29620503 ACTTCTGCCCCTCAGCTGCAGGG + Intronic
1005956277 6:30665529-30665551 TCTCCTGCTCCCCAGCTGCCCGG + Exonic
1006020934 6:31117201-31117223 GCTGCTGCTCCCCAGCTGGGAGG + Exonic
1006052572 6:31355792-31355814 ACTTCTGCTCCTGATCTGAGTGG + Intronic
1006387471 6:33739363-33739385 CCTCCTGCTCCTGAGCTGTGTGG + Intronic
1006544926 6:34772703-34772725 TGTTCTACTTCTCAGCTGGGTGG - Intronic
1007973181 6:46073715-46073737 TCATCTGCTCTTCACCTATGTGG + Intronic
1008429932 6:51404098-51404120 TTAACTGCTCCTCAGCTGTATGG - Intergenic
1012024507 6:93971641-93971663 TCGTCTGCTACTCAGCTAAGTGG - Intergenic
1013341321 6:109219004-109219026 GCCTCTGCTCCTGATCTGTGTGG - Intergenic
1015062803 6:128987779-128987801 TCATCTGCTCCACAGATCTGTGG + Intronic
1016409333 6:143765526-143765548 TGTTCTGCTCCTCAGCTCCAGGG - Exonic
1016688876 6:146912826-146912848 TCTTCTCTTCCTAATCTGTGTGG - Intergenic
1017907803 6:158768830-158768852 TCTGCTGCTCATCAGCTATTTGG - Intronic
1018049888 6:159999644-159999666 TCTTCTGTTCCTCTGATCTGCGG - Intronic
1018182203 6:161234040-161234062 TGTTCTGCTCCTGAGATGTGAGG + Intronic
1018775982 6:167016470-167016492 CATTCTGATCCTCAACTGTGGGG + Intronic
1018791523 6:167151984-167152006 TCTGCTGCTCTTTAGCTGTGTGG - Intronic
1019466716 7:1193706-1193728 TCTGCCGCTCCCCAGCTGTGTGG + Intergenic
1023866960 7:44242887-44242909 TCTGCTGCTCCCCACCTCTGTGG + Intronic
1026460176 7:70607658-70607680 TCATCTGCATCTCAACTGTGTGG - Intronic
1026592245 7:71706946-71706968 TCTTCTGCTGCTCAGCTGCTGGG + Intronic
1028637529 7:93006211-93006233 TATTCTGGTCCTTATCTGTGTGG - Intergenic
1029016095 7:97316629-97316651 TCTTCTGCTCCTCTGCTGTTGGG - Intergenic
1029442175 7:100593001-100593023 TCTACTGCTCCTCACAGGTGTGG + Exonic
1032450328 7:132025059-132025081 TCCTCTACTCCTCATCTCTGAGG - Intergenic
1032671194 7:134083916-134083938 CCTTCTGCTCCTCTACTGTGTGG + Intergenic
1034389905 7:150778012-150778034 TCTTCTACTGTTCACCTGTGTGG + Intergenic
1035635612 8:1141446-1141468 TCTTCTAACCATCAGCTGTGTGG - Intergenic
1035744446 8:1951707-1951729 TACTGTGCTCCTCAGCTTTGGGG + Intronic
1036271495 8:7308316-7308338 TCAACTCCTCCTCAGCTCTGAGG + Intergenic
1036349853 8:8002033-8002055 TCAACTCCTCCTCAGCTCTGAGG - Intergenic
1036463982 8:8979125-8979147 GCTTCCGCTCCCCAGCAGTGGGG + Intergenic
1037978141 8:23228077-23228099 CCTTCTGCTCTTCTGTTGTGTGG + Intergenic
1038228613 8:25680068-25680090 TCTTCTGCTCCTCTTCAATGTGG + Intergenic
1038433477 8:27518583-27518605 GCTTTTGCTCCTGAGCTGCGTGG - Intronic
1040535411 8:48304904-48304926 TCTCCTGCCTCTGAGCTGTGCGG + Intergenic
1044246030 8:89947256-89947278 CCTTCTGCTCCTTAGGTATGTGG - Intronic
1044693436 8:94900369-94900391 CCCTCTGCTCCTGAGCTCTGAGG + Intronic
1044899958 8:96933861-96933883 TCTTCTTGTCCTTAGCTCTGTGG + Intronic
1047797236 8:128270073-128270095 TCTATTGCTTCTTAGCTGTGAGG - Intergenic
1047883976 8:129227739-129227761 TCTTATGCATCTCAGCTTTGAGG + Intergenic
1048242947 8:132762257-132762279 TATTCTGCTTCACAGCTGTCTGG + Intergenic
1048920851 8:139228747-139228769 CCTGCTGCTCATCAGCTGTGTGG - Intergenic
1049887800 9:39915-39937 TCATCTGGGGCTCAGCTGTGTGG - Intergenic
1050296175 9:4207724-4207746 TCTGCTACTCATGAGCTGTGTGG - Intronic
1050802359 9:9631124-9631146 TCTGCTACTCCTTAGCTGTGTGG + Intronic
1052853517 9:33392727-33392749 GCTTTGGCTCCTGAGCTGTGAGG - Intronic
1053411460 9:37918653-37918675 TCTGCTGCTGGTGAGCTGTGTGG + Intronic
1053681541 9:40488907-40488929 GCTTTGGCTCCTGAGCTGTGAGG - Intergenic
1053931536 9:43117237-43117259 GCTTTGGCTCCTGAGCTGTGAGG - Intergenic
1054282172 9:63136027-63136049 GCTTTGGCTCCTGAGCTGTGAGG + Intergenic
1054294632 9:63324424-63324446 GCTTTGGCTCCTGAGCTGTGAGG - Intergenic
1054392654 9:64628911-64628933 GCTTTGGCTCCTGAGCTGTGAGG - Intergenic
1054427302 9:65134120-65134142 GCTTTGGCTCCTGAGCTGTGAGG - Intergenic
1054503074 9:65887420-65887442 GCTTTGGCTCCTGAGCTGTGAGG + Intronic
1057380994 9:94567472-94567494 TCTTCTCCTGCTCTGATGTGGGG - Intronic
1057637510 9:96783647-96783669 TTTTCTGGTACTCAGCTCTGAGG + Intergenic
1057950064 9:99362757-99362779 TCTGTTGCTCTTCAGCTGTGTGG - Intergenic
1058531951 9:105914975-105914997 TCTTCTATTCCTCATCTGTTGGG + Intergenic
1058686363 9:107484363-107484385 TCTTTTGTTACTCAGATGTGAGG + Intergenic
1059161832 9:112041866-112041888 TCCTCTCCTTCTCAGCGGTGTGG - Exonic
1059332784 9:113546643-113546665 TCTGTTGCACCTCAGCTTTGTGG + Intronic
1060666665 9:125435935-125435957 TCAGTTGTTCCTCAGCTGTGTGG - Intergenic
1061794061 9:133073804-133073826 GCTGCCGCTCCCCAGCTGTGTGG - Intronic
1185998338 X:4978425-4978447 TCTTCTTCTCTTCATCTGTCAGG + Intergenic
1188494002 X:30764632-30764654 TCTCATGTGCCTCAGCTGTGAGG - Intergenic
1188842453 X:35032930-35032952 ACTCTTGCTCCTCAGCTGTCTGG - Intergenic
1190218879 X:48498086-48498108 TCTTCTGCTCCCCTCCTCTGAGG + Intergenic
1190734643 X:53248229-53248251 TTCTTTGCTCCTTAGCTGTGTGG - Exonic
1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG + Intergenic
1196330243 X:114464278-114464300 TCTGCTGCTTCCCAGATGTGTGG - Intergenic
1198029845 X:132744291-132744313 TCTAAAGCTTCTCAGCTGTGTGG - Intronic
1198396287 X:136222322-136222344 TCCTCTGCTTTTGAGCTGTGTGG - Intronic