ID: 1173945109

View in Genome Browser
Species Human (GRCh38)
Location 20:46944216-46944238
Sequence GAGCACTGGTTGGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173945109_1173945115 3 Left 1173945109 20:46944216-46944238 CCTGTTTTGGCCAACCAGTGCTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1173945115 20:46944242-46944264 TGCGCAGATCCCTGTGGTGATGG 0: 1
1: 0
2: 2
3: 6
4: 166
1173945109_1173945112 -3 Left 1173945109 20:46944216-46944238 CCTGTTTTGGCCAACCAGTGCTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1173945112 20:46944236-46944258 CTCCCGTGCGCAGATCCCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 80
1173945109_1173945121 24 Left 1173945109 20:46944216-46944238 CCTGTTTTGGCCAACCAGTGCTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1173945121 20:46944263-46944285 GGGAGACAATTGCAAGGGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 132
1173945109_1173945122 25 Left 1173945109 20:46944216-46944238 CCTGTTTTGGCCAACCAGTGCTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1173945122 20:46944264-46944286 GGAGACAATTGCAAGGGTCAGGG No data
1173945109_1173945119 18 Left 1173945109 20:46944216-46944238 CCTGTTTTGGCCAACCAGTGCTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1173945119 20:46944257-46944279 GGTGATGGGAGACAATTGCAAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1173945109_1173945116 4 Left 1173945109 20:46944216-46944238 CCTGTTTTGGCCAACCAGTGCTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1173945116 20:46944243-46944265 GCGCAGATCCCTGTGGTGATGGG 0: 1
1: 0
2: 1
3: 6
4: 78
1173945109_1173945120 19 Left 1173945109 20:46944216-46944238 CCTGTTTTGGCCAACCAGTGCTC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1173945120 20:46944258-46944280 GTGATGGGAGACAATTGCAAGGG 0: 1
1: 0
2: 0
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173945109 Original CRISPR GAGCACTGGTTGGCCAAAAC AGG (reversed) Intronic
900144867 1:1153844-1153866 CAGCACTGGGAGGCCAAGACTGG - Intergenic
902947297 1:19850902-19850924 GAGCACTGGTTGGACAACTATGG - Intergenic
903440923 1:23387337-23387359 GAGCACCAGATGGCCAAGACTGG - Exonic
904217517 1:28934615-28934637 GAGCACCTGATGGCCAAAGCTGG - Intronic
904811713 1:33167508-33167530 GAGGACTTGTGGGCCAATACGGG - Intronic
908124228 1:61014307-61014329 GAGCATTCTTTGGCCACAACCGG + Intronic
908127728 1:61047904-61047926 GAGACCTGTCTGGCCAAAACAGG - Intronic
909871551 1:80745384-80745406 AAGCACTGGTTGCACAAAATTGG + Intergenic
911161732 1:94688382-94688404 AAGAACTTTTTGGCCAAAACTGG - Intergenic
914322593 1:146579585-146579607 AAGCACTGGTTGAACAAAAATGG - Intergenic
914363526 1:146957513-146957535 GTGCCCTGGTTGGCAAAGACTGG - Intronic
914701695 1:150139809-150139831 GAACTCTGGTAGGCCGAAACAGG - Intronic
914974369 1:152346617-152346639 GAACTCTGGGTGGCCAAAATGGG - Intergenic
915784729 1:158597284-158597306 GAGCACTGGGTGACCAAACCTGG + Intergenic
916532728 1:165673585-165673607 CAGCACTGATTGGCCAACTCTGG + Intronic
917615846 1:176743437-176743459 GAGCACTGGTGGCCAAAATCAGG - Intronic
920063904 1:203250655-203250677 GAGCTCTCGGTGGCCAAAGCTGG - Intronic
920140048 1:203803851-203803873 CAACACTGGTTGGCCAAGGCAGG - Intronic
924624418 1:245687535-245687557 GGGCTCTGGGTGGCCAAACCGGG - Exonic
1063423783 10:5935575-5935597 TAGTACTTGTTGGCCATAACTGG + Intronic
1065746604 10:28848121-28848143 GAGCACTGGTTGGGAAAACATGG + Intronic
1067037726 10:42932326-42932348 GAGCACTAGGTGGGCAAACCTGG + Intergenic
1068832111 10:61507368-61507390 GAGCACAGATTAGCCACAACTGG - Intergenic
1070109962 10:73476105-73476127 CAGCACAGGTTGGCCAAGTCAGG - Intronic
1073248576 10:102108065-102108087 GAGCACTGGGTGGCCACAGCAGG + Exonic
1073878862 10:107956482-107956504 TATCACTGGTGGGCCAAAATTGG - Intergenic
1074698498 10:116072469-116072491 GAGCACAGGTTGGCCAAGCACGG + Intronic
1074792418 10:116903895-116903917 GAACACTGGGTGGCTTAAACAGG - Intronic
1080013570 11:27482124-27482146 TAGGACTGGTTGGCAAAATCTGG + Intergenic
1082952851 11:58835908-58835930 GAACACTGGTGGGGCAAAGCAGG + Intronic
1087200719 11:95341736-95341758 CAGCACTGGAGGGCCAAAGCAGG - Intergenic
1087899915 11:103628827-103628849 GAGCACAGTTTGGCCAACTCTGG - Intergenic
1092097138 12:5852102-5852124 GAGATAGGGTTGGCCAAAACAGG + Intronic
1100581622 12:95944661-95944683 CAGCACTGGGAGGCCAAACCAGG - Intronic
1102283384 12:111635882-111635904 CAGCACTGGTTGTCCTAATCAGG - Intergenic
1105388602 13:19956157-19956179 GATTACTGGTTGCCCAGAACTGG - Intergenic
1109701985 13:66037992-66038014 GAGCTCTGATTGGCCAAGATTGG - Intergenic
1109855489 13:68121312-68121334 GATGACTGGCTGGCCAAAAGAGG + Intergenic
1111997090 13:95175878-95175900 CAGCCCTGGCTGGCCAACACAGG + Intronic
1113884389 13:113650830-113650852 AAGGGCTGGTTTGCCAAAACTGG + Intronic
1114307244 14:21435069-21435091 GGGGACTGGTGGGCCAACACTGG - Intronic
1118578509 14:67269041-67269063 GATCAGTGGTTGCCTAAAACTGG - Intronic
1118775869 14:68973726-68973748 AAGTACTGTTTGGCCAAACCTGG - Intronic
1122564707 14:102644609-102644631 GAGCTTTGGGTGGCCACAACTGG - Intronic
1124961821 15:34403898-34403920 GGGCACAGGTTCTCCAAAACAGG - Intronic
1124978446 15:34550119-34550141 GGGCACAGGTTCTCCAAAACAGG - Intronic
1125996874 15:44170274-44170296 CAGCACTGGGAGGCCAAGACAGG + Intronic
1126810691 15:52400465-52400487 GAGCACTGTTAGGCCAACAAAGG - Intronic
1127431147 15:58909866-58909888 GAGCAAGGGTTGGCAAAAACAGG - Intronic
1129486206 15:75874872-75874894 GGGCACAGGTTCCCCAAAACAGG + Intronic
1130266162 15:82405745-82405767 GGGCACAGGTTCTCCAAAACAGG + Intergenic
1130505849 15:84541130-84541152 GGGCACAGGTTCTCCAAAACAGG - Intergenic
1130843018 15:87719415-87719437 GAACTCTGGTTGGCCAGTACAGG - Intergenic
1131388994 15:92032136-92032158 TAGCAATGTTTGGCCAAGACTGG + Intronic
1134477537 16:14588931-14588953 GAGCATTGGGAGGCCAAAGCAGG + Intronic
1135394792 16:22123002-22123024 GGGCACTGGTTCTCCAAATCAGG - Intronic
1140539972 16:75747902-75747924 CAGCAGTGGGTGGCCAAATCTGG + Intronic
1141043701 16:80694922-80694944 GAGCTCCCGATGGCCAAAACTGG + Intronic
1141850534 16:86642258-86642280 GAGCTTTGATTGGCCAAAGCAGG - Intergenic
1143997727 17:11022390-11022412 GAGCAAAGTTTGGGCAAAACTGG + Intergenic
1144077786 17:11734550-11734572 GAGCACTGGCTGGGACAAACTGG - Intronic
1148975397 17:51523271-51523293 GAGCTCCCGATGGCCAAAACTGG - Intergenic
1151741209 17:75983497-75983519 AAACACTGGTTGTCTAAAACAGG - Intronic
1159837185 18:73352606-73352628 GAGCACTGCTGGGCCAGAATGGG + Intergenic
1164221038 19:23194051-23194073 CAGCACTGATAGGCCAAGACAGG - Intergenic
932175894 2:69601545-69601567 GAGCCCTGGGTGACCAAAATAGG + Intronic
936512030 2:113156484-113156506 GAGCCCTGATTGGCCAAGGCAGG - Intergenic
938405127 2:131028258-131028280 GAGCACGGTTTGTCCAACACAGG + Intronic
941137823 2:161739352-161739374 AAACATTGGTTGGCCAAAATAGG - Intronic
944008204 2:194937960-194937982 GAGCTCTCATTTGCCAAAACTGG + Intergenic
944710616 2:202331994-202332016 GAGCTCCCGATGGCCAAAACTGG - Intergenic
945296469 2:208176029-208176051 GATCACTGGTTGTCCAAAAGAGG + Intronic
948455312 2:238101981-238102003 CAGCACTGGGTGTCCAAAACGGG - Exonic
1172021398 20:31916871-31916893 TAGGTCTGATTGGCCAAAACTGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173373133 20:42458004-42458026 TAGCACTGGTTGGTCAAAGTTGG + Intronic
1173945109 20:46944216-46944238 GAGCACTGGTTGGCCAAAACAGG - Intronic
1174045330 20:47729027-47729049 GGGCACTGGTGGGAAAAAACTGG + Intronic
1174075767 20:47935023-47935045 GAGCACAGATTGGCCAGTACGGG + Intergenic
1177234916 21:18376013-18376035 TAGTACTTGGTGGCCAAAACTGG + Intronic
1182237915 22:28891001-28891023 GAGCACTGGGAGGCCAAGGCAGG - Intronic
1182825812 22:33263651-33263673 GAGCACAGGTCTGCCATAACTGG + Intronic
949409805 3:3751255-3751277 GATCAGTGGTTGTCCAGAACTGG - Intronic
953827866 3:46269643-46269665 GAGCTCTGCATGGCCAACACAGG + Intergenic
955108508 3:55924421-55924443 GAACACTGGTTGGCCAACTATGG - Intronic
955647176 3:61152297-61152319 GAGAACTGGTTGCCAAAAAGTGG + Intronic
962477414 3:135767552-135767574 GAACCCTGATTGGCCAAAGCAGG - Intergenic
962615019 3:137116945-137116967 GAAACCTGGTTGGCAAAAACTGG + Intergenic
966539905 3:181077773-181077795 CAGCAGTGATTGGCAAAAACTGG + Intergenic
969273479 4:6118745-6118767 GAGCTCTGGTTGGCCAACATGGG + Intronic
973970919 4:56213052-56213074 GAGCACTGAATGGCCAAGACAGG - Intronic
980396970 4:132226987-132227009 GAGCAATGGTTAGCATAAACTGG - Intergenic
981026895 4:140085613-140085635 CAGAGCTGCTTGGCCAAAACGGG + Intronic
981266192 4:142786326-142786348 GAGCTCCGTTTGGCCAAAGCTGG + Intronic
982604616 4:157498669-157498691 GAGCACCCAATGGCCAAAACTGG - Intergenic
984362208 4:178749304-178749326 AAGCACTGAGTGGCCAAACCTGG - Intergenic
985497205 5:216037-216059 CATCACTGGTTTTCCAAAACTGG + Intronic
985738374 5:1598916-1598938 CATCACTGGTTTTCCAAAACTGG - Intergenic
986925602 5:12744917-12744939 TAGCACTGGGAGGCCAAAATGGG - Intergenic
993319483 5:86455874-86455896 GAGCACTGATTGGCAAAGAATGG + Intergenic
995180706 5:109227910-109227932 GAGCACTGGTGGGGCAGGACTGG + Intergenic
996067103 5:119091456-119091478 CAACACTGGGAGGCCAAAACAGG - Intronic
996447821 5:123577067-123577089 GAGCAACGGGTGGCCAAATCTGG - Intronic
1000270024 5:159675649-159675671 GTGCACTGGTAGGGCAAACCTGG + Intergenic
1001685184 5:173589156-173589178 GAGACCAGCTTGGCCAAAACTGG + Intergenic
1007262252 6:40571962-40571984 GAGCACAGGGTCTCCAAAACAGG + Intronic
1007645828 6:43380180-43380202 GAGGACTGGGTGGCCAAAAAAGG + Intergenic
1009445642 6:63739163-63739185 GAGCTCTAGCTGGCCAAATCAGG - Intronic
1010567774 6:77438167-77438189 GAGCTCTAGATGGCCAAAGCTGG + Intergenic
1015933858 6:138388670-138388692 GAGCAGAGGCTTGCCAAAACAGG + Intergenic
1016121806 6:140352584-140352606 GACCCCTTGTTAGCCAAAACTGG - Intergenic
1021838703 7:24705489-24705511 GGGGACTGGTTTGCCACAACTGG + Intronic
1022578266 7:31520453-31520475 GAGCTCTTATTGGCCAAAGCTGG - Intronic
1029099555 7:98117474-98117496 GAGCTCTCGATGGCCAAAGCTGG - Intronic
1031929816 7:127673791-127673813 GAGCTCTCATTAGCCAAAACTGG - Intronic
1032219913 7:129986847-129986869 GAACATTGGTAGGCCAAAGCGGG - Intergenic
1038198096 8:25386332-25386354 CAGCACTGGTAGGCCAAGGCAGG + Intronic
1038442613 8:27582541-27582563 GAGCACTGGTTGGCAGTATCTGG - Intergenic
1040424209 8:47268702-47268724 GAGCTTTGGGAGGCCAAAACAGG - Intronic
1043523816 8:81074469-81074491 GAGTACTGGTGGGCCACAAATGG + Intronic
1043801115 8:84610804-84610826 GAGCTCTGAGTGGCCAAAGCTGG - Intronic
1051585320 9:18721175-18721197 GAGCACAGGGTGGCAAAAAAGGG - Intronic
1056281126 9:85042016-85042038 GAGCACTGATTGGAACAAACAGG + Intergenic
1057583322 9:96307065-96307087 GAGAACTGGATCTCCAAAACAGG + Intergenic
1058646494 9:107135865-107135887 GAGCACTGGATGTTCAAACCAGG - Intergenic
1060029557 9:120202628-120202650 GAGCCCTGATTGGCCAAGGCAGG - Intergenic
1189447343 X:41093111-41093133 CAACACTGGGAGGCCAAAACAGG - Intronic
1190302420 X:49064551-49064573 GAGCACTGGGAGGCCAAGGCGGG - Exonic
1202364112 Y:24143486-24143508 GGGCACAGGTTCTCCAAAACAGG + Intergenic
1202506668 Y:25526636-25526658 GGGCACAGGTTCTCCAAAACAGG - Intergenic