ID: 1173948188

View in Genome Browser
Species Human (GRCh38)
Location 20:46968309-46968331
Sequence GTGTGGGATGAACCCAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173948185_1173948188 -2 Left 1173948185 20:46968288-46968310 CCTTTTACTGTAACATGCATTGT 0: 1
1: 1
2: 4
3: 20
4: 215
Right 1173948188 20:46968309-46968331 GTGTGGGATGAACCCAAGAATGG 0: 1
1: 0
2: 0
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173948188 Original CRISPR GTGTGGGATGAACCCAAGAA TGG Intronic
901551970 1:10002150-10002172 ATGTGGGTTGAAGGCAAGAAGGG - Intronic
902035651 1:13456181-13456203 GGGAGGGATGTACCCCAGAAAGG + Intergenic
902104690 1:14024706-14024728 GTGTGGGATAAACCCAGGGGAGG + Intergenic
904033852 1:27548961-27548983 GTGGGGGCTGAACCAGAGAAGGG + Exonic
905731144 1:40300299-40300321 CTGTGGGAGGAACCTAGGAATGG - Intergenic
906781555 1:48577181-48577203 GTGTGGGAAGAGCCCAAAAGTGG - Intronic
908390862 1:63682422-63682444 GTGTGTGAGGAACCCATGACAGG - Intergenic
911372740 1:97013831-97013853 GGGTGGGACAAACGCAAGAAAGG + Intergenic
913192590 1:116426210-116426232 CTGTGGGATGAGGACAAGAAGGG + Intergenic
916424727 1:164669650-164669672 TTGTTGCATGAACCCAGGAAAGG - Intronic
918364421 1:183791474-183791496 CTTTTGGATGAAACCAAGAATGG - Intronic
918882193 1:190138969-190138991 GTTTAGAATCAACCCAAGAAAGG + Intronic
919781857 1:201226179-201226201 CAGTGGGATGCACCCAAGCATGG + Intronic
1062980123 10:1715028-1715050 GTGTGTGATGTTCCCAACAAGGG + Intronic
1063359654 10:5441217-5441239 GTGTGGGATGGACACCCGAAAGG - Intronic
1065878333 10:30016961-30016983 GTGTGAGAGGAACCCAAAGAGGG - Exonic
1067343731 10:45423430-45423452 GTGTGGGATGGGTCCAGGAAAGG - Intronic
1067785764 10:49245290-49245312 ATGTGGAATGATTCCAAGAAAGG + Intergenic
1068392012 10:56409655-56409677 GTGTGGATTGAACCAAAGGAGGG - Intergenic
1069878885 10:71579579-71579601 GTCTGGGATGGGCCCAAGAATGG + Intronic
1069961856 10:72083865-72083887 GTGTGAGAAGAACCCAAAAGTGG - Intronic
1072261518 10:93679425-93679447 GTGGGGGATGAAATCAGGAAAGG + Intronic
1074881136 10:117660271-117660293 GTGTGTGATGAGCCCAAGAGTGG - Intergenic
1075443928 10:122500879-122500901 GTTTAGGAAGAACCCAAGCAGGG - Intronic
1076033836 10:127182246-127182268 GTGGGGGCTGAACCTAAGATAGG - Intronic
1076877840 10:133225413-133225435 GTGGGGGGTGAACCCAGGCAGGG - Exonic
1078195317 11:9132322-9132344 GTGTGGGTGGAAGCCAAAAATGG + Intronic
1078475272 11:11623742-11623764 GTTTAGGAAGATCCCAAGAAGGG - Intergenic
1078727318 11:13943182-13943204 GAATGGGATGAACCCCAGAAAGG + Intergenic
1079810330 11:24990875-24990897 ATTTGAGATGAACCCATGAAAGG - Intronic
1083343870 11:61976079-61976101 ATGTGGGAGGAAAGCAAGAAGGG + Intergenic
1085718352 11:78892343-78892365 CTGTTGCATGCACCCAAGAAAGG + Intronic
1085920897 11:80955828-80955850 ATGTGGCATGAACGCAAGCAGGG - Intergenic
1086864105 11:91959409-91959431 CTGTGGGATAAAGCCAAGGATGG - Intergenic
1088994693 11:114986286-114986308 TTGTGGCATGAACCCAGGCATGG + Intergenic
1089102342 11:115974050-115974072 TGGTGGGATGAATCCAAGACCGG - Intergenic
1089384513 11:118059042-118059064 GTGTGGGACAAACCCAAGTGTGG - Intergenic
1089794694 11:120970746-120970768 GGGAGGGATGAACAAAAGAAAGG - Intronic
1090412906 11:126521198-126521220 CTGTGGGATGATCCCCAGAGGGG + Intronic
1090528242 11:127560884-127560906 GTGTGGCATGCACACAAGGAAGG + Intergenic
1091351534 11:134901485-134901507 GTGTGGAATGACCCCAAGCAGGG - Intergenic
1092149792 12:6239747-6239769 GAGTGGGATGAACAGGAGAAAGG + Intergenic
1094303773 12:28995243-28995265 GTCTATGATGAACCCATGAAAGG + Intergenic
1095511368 12:42954578-42954600 TAGTGGGAGGAACCCCAGAATGG - Intergenic
1096629479 12:52916668-52916690 GTGTGGGATGAACCAAGCTAAGG - Intronic
1100346221 12:93734085-93734107 GTGAGGGAGGAAGACAAGAAGGG - Intronic
1103119853 12:118372036-118372058 GTGTGAGAAGACCCCAGGAAGGG - Intronic
1103743245 12:123105545-123105567 GTGTGTGAAGAAACAAAGAAAGG + Intronic
1103902959 12:124312844-124312866 ATGTGGGATGTTCCCAAGCAGGG - Intronic
1107797331 13:44065989-44066011 GAGTGGGAAGAATCCTAGAAAGG + Intergenic
1109255895 13:60081710-60081732 GTATGGGAAGAACCAAAGGAAGG + Intronic
1109322312 13:60826083-60826105 GTGAAGGAAGAACTCAAGAAAGG - Intergenic
1115467540 14:33732192-33732214 GTGTGGGATGAGGCGAAGAGAGG - Intronic
1115906904 14:38210720-38210742 TTGATGGAGGAACCCAAGAAAGG + Exonic
1115960363 14:38829732-38829754 GTGTGGGATGAAATGAACAAAGG + Intergenic
1120791726 14:88590232-88590254 GTGTGGGATGGACTGAAGGAAGG - Intronic
1125759783 15:42088657-42088679 CTGTGGGCTGACCCCAAGGAAGG + Intronic
1127624964 15:60771357-60771379 GTGTGAGATGTACCAATGAATGG - Intronic
1127743504 15:61938440-61938462 GCCTGGGATGCAGCCAAGAAAGG - Intronic
1128720506 15:69944164-69944186 GTGTGGGAGGACCCCTAGAGAGG - Intergenic
1129150222 15:73683993-73684015 GTGGAGGAAGAACCCAAGACTGG + Intronic
1130157753 15:81367656-81367678 GGGTGGGATTAACTCAGGAAAGG + Intronic
1132493667 16:249262-249284 GAGTGGGATGAACCGAACAAGGG + Intronic
1132871982 16:2119431-2119453 GTGTGGGATGGGCCCAGGGATGG - Intronic
1132900806 16:2253128-2253150 GTGTTGAATAAACCCAAGATCGG - Exonic
1134520545 16:14917465-14917487 GTGTGGGATGGGCCCAGGGATGG + Intronic
1134551029 16:15138509-15138531 GTGTGGGATGGGCCCAGGGATGG - Intronic
1134708217 16:16316116-16316138 GTGTGGGATGGGCCCAGGGATGG + Intergenic
1134715432 16:16356149-16356171 GTGTGGGATGGGCCCAGGGATGG + Intergenic
1134951385 16:18352529-18352551 GTGTGGGATGGGCCCAGGGATGG - Intergenic
1134959325 16:18396010-18396032 GTGTGGGATGGGCCCAGGGATGG - Intergenic
1140210265 16:72963928-72963950 GTCTGGTAGGAAACCAAGAAGGG + Intronic
1144949785 17:18987825-18987847 ATTTGGGCTTAACCCAAGAAAGG + Intronic
1145244867 17:21262118-21262140 GTGGGGGATGAACCCTGGAGGGG + Intergenic
1146089197 17:29859261-29859283 GTGTAAGAGGAACCCAGGAAAGG - Intronic
1146535912 17:33651962-33651984 GTGTGGCAGGAATCCCAGAAAGG + Intronic
1148091191 17:45023312-45023334 GTGTGGGAAGAAGCCAAGTCTGG + Intergenic
1149147651 17:53516428-53516450 GTGTAAGATTAAACCAAGAAAGG + Intergenic
1149219617 17:54401531-54401553 GTGAGGGGTGCACCCAAGCATGG - Intergenic
1150587068 17:66528484-66528506 GTGAGGGATGAACTCACAAAAGG + Intronic
1150632931 17:66892871-66892893 GCTTGGGATTCACCCAAGAATGG + Intergenic
1151635512 17:75345128-75345150 GAATGGGATGAACCCAGGAGCGG - Intronic
1151689593 17:75673756-75673778 GGGTGGGAGGGACCCAAAAAAGG + Intronic
1152120848 17:78417424-78417446 GTGTGGCATGGACCCACGATGGG + Intronic
1152333940 17:79689601-79689623 TTGGAGAATGAACCCAAGAAGGG - Intergenic
1152729492 17:81962425-81962447 GGGTGGGATGGACAAAAGAAAGG + Intergenic
1156341746 18:36215619-36215641 GTCTATGATGAACCTAAGAAAGG - Exonic
1159921099 18:74228072-74228094 GTCTGGGATGGACCCAAGGTGGG - Intergenic
1160506009 18:79427262-79427284 GTGTGGAATGGACCCAGGGAAGG + Intronic
1161439788 19:4284472-4284494 GTCTGGGCTGAACCCCAGAAGGG + Intronic
1164468805 19:28511095-28511117 GTGTGGGAGCAATCCCAGAATGG + Intergenic
1165941030 19:39414912-39414934 GTGTGGGCTGAACGCATGAAAGG + Intronic
925707689 2:6702720-6702742 GTGTAGGTTGAACAGAAGAATGG - Intergenic
926083547 2:10007167-10007189 GTGTGGGATGGAACCTGGAAAGG - Intergenic
927393660 2:22624772-22624794 GTGGGAAATGAACCCAAGTAGGG + Intergenic
929457047 2:42073401-42073423 GTGGGAGATGAACCCAAGTTAGG - Intergenic
930901811 2:56516237-56516259 GTGTGGAAAGAAAGCAAGAATGG + Intergenic
931430062 2:62202246-62202268 GTGTTGGAGGCAGCCAAGAAAGG + Intronic
931893217 2:66698750-66698772 GTGGGGGATGGACGCAAGCAGGG - Intergenic
932068735 2:68594405-68594427 GTGTGGGTAGAAACCAAGATTGG - Intronic
932436819 2:71706598-71706620 GTGTGGGAAGAGGACAAGAAAGG + Intergenic
933159250 2:79006334-79006356 GTGTGTGCTGAACACAGGAAGGG + Intergenic
935339417 2:102046327-102046349 GTGTGGGATAAACACCAGACTGG - Intergenic
936082236 2:109440265-109440287 GTGTGGGAAGCACTCAGGAAGGG + Intronic
937903681 2:127041259-127041281 GTGTGGAATGAGTCCAAGGACGG + Intergenic
938621486 2:133059210-133059232 GAATGGCATGAACCCAGGAAGGG + Intronic
941431310 2:165417574-165417596 GTGTGAGATAAAGCCATGAATGG + Intergenic
941820561 2:169840445-169840467 GTGTGGACTGCACCCAAGAGAGG - Intronic
945045220 2:205775935-205775957 GTATGGGATTCAACCAAGAATGG - Intronic
1169920108 20:10726262-10726284 ATTTGGGGTGGACCCAAGAATGG + Intergenic
1170587390 20:17745128-17745150 GGGTGGGATGGGCCCAAGGAGGG + Intergenic
1173948188 20:46968309-46968331 GTGTGGGATGAACCCAAGAATGG + Intronic
1174513989 20:51077020-51077042 GTTTGGGATGGAGCCAGGAAAGG + Intergenic
1178263661 21:31122822-31122844 GACTGGGAAGAACCCAATAATGG - Intronic
1178981787 21:37270429-37270451 GTGTGGGCTGCCCCCTAGAAGGG - Intergenic
1179511512 21:41877045-41877067 GGGTGGGATGAGCCCAGGATGGG - Intronic
1184287759 22:43481622-43481644 GCCTGGGAGGAACCCCAGAAAGG - Intronic
955337077 3:58095624-58095646 CTGAGGGAGGAACCAAAGAATGG - Intronic
955996850 3:64687385-64687407 GTTGGGGATGACCCAAAGAAGGG + Intronic
956538295 3:70304562-70304584 GTGTGGGGTGATACAAAGAAAGG - Intergenic
957118407 3:76057277-76057299 GTGTTGTATAAACCCAAGGATGG - Intronic
958028613 3:88079017-88079039 GTTTGGGCTGAAACTAAGAATGG + Intronic
959379673 3:105626852-105626874 GTGTGGGATGAGAGCAAGAAGGG + Intergenic
959495791 3:107049936-107049958 CTTTGGGATATACCCAAGAATGG - Intergenic
960603891 3:119485127-119485149 GAATGGCATGAACCCAGGAAGGG + Intronic
961351237 3:126305676-126305698 GTGTGGGAGGAAGGCAAGAGTGG + Intergenic
962293218 3:134154688-134154710 GTGTTGCAGGAGCCCAAGAAAGG - Intronic
964046417 3:152333012-152333034 GTGTGGGCTGAAACCAACATTGG - Intronic
967171229 3:186825046-186825068 GTGAGGGAGGAACGGAAGAACGG - Intergenic
969351894 4:6603006-6603028 GTATGGGCTGATCCCTAGAAAGG + Intronic
970002032 4:11373705-11373727 GTGTTGAATAAACCCAAGATCGG + Intergenic
970506703 4:16738180-16738202 GTTTGGGAGGAACCTAAAAATGG + Intronic
970878565 4:20901263-20901285 GTATGGGAAGAACTGAAGAAAGG - Intronic
975484842 4:74924460-74924482 GAATGGGGTGAACCCAGGAAGGG - Intergenic
975869302 4:78760580-78760602 ATATGGGAAGAACCCAAGCATGG + Intergenic
979938490 4:126727905-126727927 GAGTGAGATGATACCAAGAAGGG + Intergenic
983619437 4:169744837-169744859 GTGTTGAATAAACCCAAGATTGG - Intronic
988557507 5:32250388-32250410 GTGTGGCTTGGCCCCAAGAAAGG - Intronic
988748224 5:34166347-34166369 CTGTGGGATGTACCGAAAAAAGG + Intergenic
988989002 5:36651205-36651227 GTGGGGAAGGAACCCAAGGAGGG - Intronic
989031718 5:37126299-37126321 GTGTGGCATGAACCTAAGCATGG - Intronic
990370349 5:55111711-55111733 GTTTGGGATCTACCCAGGAATGG - Intergenic
993111612 5:83663695-83663717 GTCTGGCATGAACCGAAGGATGG - Intronic
996465625 5:123799236-123799258 AGGTGGTATGAACACAAGAATGG + Intergenic
999258454 5:150222854-150222876 GGGTGGGGAGACCCCAAGAAGGG - Intronic
999648149 5:153739170-153739192 GTGAGGAATGAAGCCAAGCAGGG - Intronic
1001435395 5:171695684-171695706 GTGCTGGTGGAACCCAAGAAGGG - Intergenic
1007757801 6:44111650-44111672 GTGTGGGTTGAAGCCAAAAGAGG - Intergenic
1011078341 6:83462117-83462139 ATGGGAGATGAACTCAAGAAAGG - Intergenic
1011163717 6:84421835-84421857 TTTTGGAATGAACTCAAGAAAGG + Intergenic
1011579895 6:88850294-88850316 AAGTGGTATGAAACCAAGAAAGG - Intronic
1012591086 6:100982309-100982331 GTGTGATATGAACCCAAGGATGG - Intergenic
1017150928 6:151279429-151279451 GTGTGTGATTAACTTAAGAATGG + Intronic
1019901655 7:4025902-4025924 GTGTGGGCGGCACCCAGGAAGGG - Intronic
1024705000 7:51947374-51947396 GTGTTAGATGAACAAAAGAATGG + Intergenic
1025811215 7:64876848-64876870 GTGTGGGTTGGACCCCAGCACGG + Intronic
1026837836 7:73649963-73649985 GTGTGGGATGGAAAGAAGAAAGG + Intergenic
1026850972 7:73722972-73722994 GTGGGGGATGAGCCCAAGGAAGG + Intergenic
1031668445 7:124514600-124514622 ATATGGCAAGAACCCAAGAACGG - Intergenic
1033445738 7:141420354-141420376 ATGTAGGATGAACCCAAAGAGGG + Intronic
1035061648 7:156073863-156073885 GTGGGGAATGAACCCAATACTGG - Intergenic
1036221904 8:6928488-6928510 GGGTGGGGTTAACTCAAGAAAGG - Intergenic
1038360735 8:26873435-26873457 GTGTGGCATGAATGCAGGAATGG - Intergenic
1045535886 8:103027415-103027437 GTATGGGATTGACCCAAGATAGG - Intronic
1046725492 8:117669249-117669271 GTGTGTGGTGAACTCAGGAAAGG + Intergenic
1046731998 8:117736070-117736092 GAGTGGGATGTTGCCAAGAATGG - Intergenic
1047933487 8:129752472-129752494 GTGTGGGCTGAGCCCAAGCAGGG + Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049207423 8:141370023-141370045 CTGAGGGATGAAGCCAACAACGG + Intergenic
1050012437 9:1198886-1198908 GAATGGGATGAAACCAAGGAGGG - Intergenic
1051006079 9:12346184-12346206 GTGATGGATGAATCCAAGAGGGG + Intergenic
1056254845 9:84788624-84788646 GTGTGGGATGAGCTCAAGGTGGG + Intronic
1056310946 9:85340203-85340225 GTGTGGGATGGAGAGAAGAAAGG - Intergenic
1061703101 9:132431060-132431082 GTGAGGGAAGAATCCAGGAAAGG + Intronic
1186438440 X:9564314-9564336 GTGAGGGAGTAAACCAAGAAAGG + Intronic
1187523553 X:20034435-20034457 GTATGGGATGCAACTAAGAAGGG - Intronic
1189200814 X:39194226-39194248 ATGTGGGTTGCCCCCAAGAAGGG + Intergenic
1190130983 X:47748832-47748854 GGATGGGAAGAACACAAGAATGG - Intergenic
1192764903 X:74130274-74130296 AAGTGGGCTGAATCCAAGAAAGG + Intergenic
1194076524 X:89400672-89400694 GTGTGAGATAAAACCAGGAATGG + Intergenic
1195690243 X:107618334-107618356 GTGTGGGGTGAAGCAAGGAAGGG - Intergenic
1196989494 X:121312307-121312329 GTGTGGGATGGAGCCTAGGATGG + Intergenic
1197755939 X:129994858-129994880 GTTTGGGATGAACAGCAGAAAGG + Intronic
1200429164 Y:3056192-3056214 GTGTGAGATAAAACCAGGAATGG + Intergenic
1200848634 Y:7859239-7859261 ATGTGGGTAGGACCCAAGAAGGG + Intergenic
1202252054 Y:22883382-22883404 ATGTGGGCAGAACCCAAGCAGGG + Intergenic
1202405042 Y:24517131-24517153 ATGTGGGCAGAACCCAAGCAGGG + Intergenic
1202465737 Y:25152951-25152973 ATGTGGGCAGAACCCAAGCAGGG - Intergenic