ID: 1173948260

View in Genome Browser
Species Human (GRCh38)
Location 20:46968747-46968769
Sequence TTTGCTGCCCAGAGGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173948260 Original CRISPR TTTGCTGCCCAGAGGACACC TGG (reversed) Intronic
900565871 1:3331629-3331651 TTTGCTGCCCAGAGGAATCCTGG + Intronic
900613472 1:3554063-3554085 CTTGTTCCCCACAGGACACCAGG - Intronic
900799212 1:4727202-4727224 TTTGCAGCCCAGCGGGCAGCAGG + Intronic
900948664 1:5845286-5845308 TTTGCTGCCGAGTGGACACGGGG - Intergenic
900958820 1:5906402-5906424 GTTTCAGCCCAGAGGAAACCAGG + Intronic
900985480 1:6070791-6070813 TTTCCTGGCTGGAGGACACCGGG - Intronic
901192324 1:7420036-7420058 TTTCCTGCTCAGAAGCCACCAGG + Intronic
901537220 1:9890437-9890459 TTTTCTTCCCAGAGAACAGCTGG + Intronic
901699566 1:11037808-11037830 TGCGCTGCGCAGAGGAAACCAGG + Exonic
902196505 1:14802434-14802456 TTTGCCACCCAGGGGACACTGGG + Intronic
902925209 1:19691395-19691417 GTCCCTGCCCAGAGGTCACCTGG - Intronic
903741375 1:25560484-25560506 TTTGGAGCCCAGAGGCCTCCCGG - Intronic
903809736 1:26028655-26028677 ACTGCTGCCCAGAGGTCCCCTGG - Intronic
904019032 1:27448091-27448113 TTTGCTGCCAAGAGGTCAGAGGG - Intronic
904456685 1:30651997-30652019 TTTGCTGCCCAGGGGACAGCTGG - Intergenic
904799794 1:33084194-33084216 CTTGCTCCCCAGAGCCCACCTGG - Intronic
904823796 1:33261839-33261861 TCTGCTACCCAGAGGCCAACAGG + Intronic
905315309 1:37079087-37079109 TTTGCCCCCCAGGGGACACTTGG - Intergenic
905675342 1:39820699-39820721 TTTGCTGCCCAGAGCACCATTGG - Intergenic
907833423 1:58086783-58086805 TTTGCTGACCAGAGAACAAAGGG - Intronic
908191872 1:61712075-61712097 TTTACTCCCCAGAGGACATTTGG + Intronic
908591035 1:65633843-65633865 TGTGCTGCCCACAGGACAGTGGG + Intronic
910144678 1:84065774-84065796 TTTGTAGCCCAGAGGTCAGCTGG + Intergenic
912583230 1:110738370-110738392 CATCCTGCCCAGAGGGCACCTGG + Intergenic
912920102 1:113858308-113858330 TTGGCCTCCCAGAGTACACCTGG + Intronic
916142778 1:161713701-161713723 TTTGCCCCCCAGAGGACATTGGG + Exonic
916489953 1:165293188-165293210 CTTGCTTCCCTGAGGACATCTGG - Intronic
917534818 1:175866733-175866755 TTTGCTCCACAGTGGACTCCTGG - Intergenic
918613276 1:186515904-186515926 TCTGTTGCCCAGGGGACATCTGG - Intergenic
919417810 1:197333103-197333125 TTTGCTGCTCAGAGGAACACAGG - Intronic
920193628 1:204211766-204211788 TTTGTTTCCCAGGGGACATCTGG + Intronic
923001807 1:230012225-230012247 TTTACTGTCCAAAGAACACCAGG + Intergenic
924413739 1:243835258-243835280 TTTGGTCCCCAGAGGACATTTGG - Intronic
1063035449 10:2282302-2282324 TTTGCAGCCAAGAGTACCCCAGG - Intergenic
1063196267 10:3746809-3746831 TGTTCTGTCCAGAGGACACACGG - Intergenic
1063587640 10:7366928-7366950 TTTACCCCCCAGGGGACACCTGG - Intronic
1064194116 10:13231587-13231609 TTTGCTGTCCTGAGTACACAGGG - Intronic
1065326767 10:24556414-24556436 TTTCCAGCCCAGAGGACACCAGG - Intergenic
1065630631 10:27677200-27677222 TGTGCTGCACACAGGAAACCTGG + Intronic
1068690599 10:59909921-59909943 TTTGCTGCCCAGGGGATATTTGG - Intergenic
1069364187 10:67679334-67679356 TTTGCTTCTCAGAGGACATTTGG - Intronic
1070933307 10:80275586-80275608 GGTGTTGCCCAGAGGACACTTGG - Intronic
1071842304 10:89485142-89485164 TTGGCTCCCCAGAGGACATTTGG + Intronic
1073332918 10:102682483-102682505 TGTGCTGCCTTCAGGACACCAGG + Intronic
1074212573 10:111350654-111350676 TTTGCTCCCCAGGGGACATTTGG + Intergenic
1074324025 10:112430204-112430226 TCTGCTGCCCTGTGGACAACTGG - Intergenic
1074383935 10:113002344-113002366 TTTGCTCACCAGAGGACATTTGG + Intronic
1074404522 10:113169492-113169514 TTTGCCCCCCAGGGGACATCTGG - Intergenic
1075546063 10:123355574-123355596 TTTGCTCCCCAGAGGACATTTGG - Intergenic
1075956805 10:126531260-126531282 TTTGCTGCCCAGGGGACATTTGG + Intronic
1076343923 10:129767715-129767737 CCTGCTGCCCAGAGCACACTAGG - Exonic
1076889184 10:133275632-133275654 TTTCCTTCCCAGAGGCCTCCTGG + Intronic
1076939205 10:133590493-133590515 GGGGCTGCCCAGAGGGCACCAGG + Intergenic
1077446465 11:2593311-2593333 TTTGCTGCTCAGAGAACACTGGG + Intronic
1077446479 11:2593386-2593408 TTTGCTGCTCAGAGAACACTGGG + Intronic
1077550771 11:3199282-3199304 CCTGCTGCTCAGAGGACACAGGG + Intergenic
1077706999 11:4496452-4496474 TTTGCTGCCGAGAGGGGTCCGGG + Intergenic
1079246943 11:18759504-18759526 ATTGCTGACCAGTGGGCACCTGG + Intronic
1079938507 11:26648582-26648604 TTTGTCCCCCAGAGGACATCTGG - Intronic
1080667624 11:34349704-34349726 TTTGCTCCCCAGGGAACATCTGG + Intronic
1080986667 11:37475317-37475339 TTTCCTTCCCCAAGGACACCTGG - Intergenic
1082796614 11:57382467-57382489 TTTTCTCCCCAGAGGACATTTGG - Intergenic
1083486615 11:62986983-62987005 TTTGCCCCCCAGGGGACACTTGG + Intergenic
1084638434 11:70409178-70409200 CTTTCTGCCCAGGAGACACCAGG - Intronic
1085196132 11:74672923-74672945 TGTGCTGCCCAGAGAAACCCAGG + Intergenic
1085276663 11:75304591-75304613 TTTGCACCCCAGGGGACACCTGG + Intronic
1085634207 11:78145675-78145697 GTTGCAGCCAAGATGACACCAGG + Intergenic
1086072659 11:82816192-82816214 TTTGCCTCCTAGAGGACAGCTGG - Intergenic
1086143485 11:83524750-83524772 TTGGCTTCCCTGAGCACACCGGG + Intronic
1087126926 11:94637537-94637559 TTTGCTGCCTAGGGGACATTTGG + Intergenic
1087229409 11:95643237-95643259 TTTGCCTCCCAGAGGACATTTGG + Intergenic
1088464039 11:110114182-110114204 ATTGTTGCCCAGAGAACAACAGG - Intronic
1088491960 11:110397084-110397106 TTTCTTTTCCAGAGGACACCGGG + Intergenic
1089153612 11:116384379-116384401 TTTCCTGCCCAGGGCACACATGG - Intergenic
1090034603 11:123237828-123237850 CTGGCTCCCTAGAGGACACCTGG + Intergenic
1090809232 11:130222108-130222130 TACGGTGCACAGAGGACACCTGG + Intergenic
1091794457 12:3289769-3289791 TTTGCAGCCCAGAGACTACCAGG + Intergenic
1091878043 12:3952766-3952788 TTTGCTGCTCAGGGGACATTTGG - Intergenic
1091929645 12:4384624-4384646 TTTGCTGTCAAGATGACACTGGG - Intergenic
1093054132 12:14537452-14537474 TTTTCTCTCCAGAGGACACTTGG - Intronic
1094409073 12:30150153-30150175 TTTCCTGCCCATAGGACATATGG + Intergenic
1096714732 12:53484238-53484260 TTTCCTACCCACAGCACACCTGG + Exonic
1097036242 12:56126345-56126367 TCTGCTGCCCAGGTGCCACCTGG - Exonic
1099696434 12:86027189-86027211 TGTGCTTCCCAGAGGTCTCCAGG - Intronic
1101738385 12:107481038-107481060 TTTGCTCCCCAGGGGACAAGTGG + Intronic
1103192242 12:119011460-119011482 TTTGCTCCCCAGGGGACATTTGG - Intronic
1103241508 12:119417198-119417220 TCTGCTTCCCAGAGGACACTTGG + Intronic
1103621280 12:122188934-122188956 TTTGCTGCTCAGGGGACATCAGG - Intronic
1104584496 12:130037148-130037170 TCTGCGGCCCAGAGAGCACCCGG + Intergenic
1104670535 12:130677074-130677096 TGTGGTGCCCAGGGGACAGCAGG + Intronic
1106357729 13:29000322-29000344 TTTGCTGCCCATAGGATTCTTGG + Intronic
1106554590 13:30798691-30798713 TTTCCTGTCCAGAGCACCCCAGG + Intergenic
1106801502 13:33261175-33261197 TTTGCTCCCCTGAGAACACAGGG + Intronic
1107053784 13:36080850-36080872 TTTGCCTCCCAGAGGACATTTGG + Intronic
1107077814 13:36342656-36342678 TTTGCTGCCCAAAGTACATTTGG - Intronic
1107931264 13:45309580-45309602 TTTGCTTCCCACAGAACCCCAGG - Intergenic
1110515361 13:76405591-76405613 TTTGCTGACCTCAGGACATCTGG + Intergenic
1110656978 13:78011818-78011840 TTTGCTTCCCAGGGGACATTGGG - Intergenic
1111750585 13:92326825-92326847 TTTACTTCCCCAAGGACACCAGG + Intronic
1114272384 14:21109456-21109478 TTTGCTTCCCAGGAGACATCTGG - Intergenic
1116971640 14:51072046-51072068 TGGGCAGCCCAGAGAACACCGGG - Intronic
1116991662 14:51283788-51283810 TTTTCAGCCCAGAAGCCACCTGG - Intergenic
1117550619 14:56832547-56832569 TTTGCTGCCCAGTGCCCACCAGG - Intergenic
1117637047 14:57754789-57754811 TTTTCTGGTCAGAGGAAACCAGG + Intronic
1119902150 14:78270339-78270361 TCTGCATCTCAGAGGACACCAGG - Intronic
1120413997 14:84195646-84195668 TTTGCTCCCAAGAGGACATTTGG + Intergenic
1120870118 14:89329410-89329432 TTTGCTCCCCAGGGAACATCTGG + Intronic
1121257479 14:92541375-92541397 TGTGCTGCTCAGGGCACACCTGG + Intronic
1122045725 14:99021823-99021845 TTTCCTTCTCAGGGGACACCTGG - Intergenic
1122540252 14:102493952-102493974 GTTGATGCCCGGAGGACACAGGG - Intronic
1125240023 15:37563712-37563734 TTTGCCACCCAGAGGACATTTGG + Intergenic
1125473609 15:40028415-40028437 TTTGCTTCCCAGGGCACATCTGG + Intronic
1125691429 15:41599247-41599269 GTTGCTGCCAATAGGACAGCAGG + Intergenic
1125775537 15:42209123-42209145 TTTGCCTCCCAGAGGACATACGG - Intergenic
1126405570 15:48319467-48319489 TCACCTGCCCAGTGGACACCAGG + Intergenic
1126882839 15:53117664-53117686 TTTGCCTCCCAGAGGACATTTGG + Intergenic
1127473934 15:59314640-59314662 TCTGCTCCCCAGAGGACATTTGG + Intronic
1128515099 15:68337184-68337206 ATGCCTGCCCAGAGGACACTTGG - Intronic
1128636930 15:69308594-69308616 TTTGCTCCCCAGTGGACATTTGG - Intronic
1128754808 15:70174543-70174565 TTGGCTGCTGAGAGGACAGCTGG - Intergenic
1132953641 16:2579138-2579160 TCTGCTCCCCAGGGGACACTTGG + Intronic
1132960710 16:2621029-2621051 TCTGCTCCCCAGGGGACACTTGG - Intergenic
1132967215 16:2664193-2664215 TTTGCTGCCGAGAGGGGTCCGGG + Intergenic
1133271707 16:4613738-4613760 TGTGCTGCCCAGAGGCTACCTGG - Intronic
1133388448 16:5389488-5389510 TTTGCCTCCCAGAGGACATTTGG - Intergenic
1133405842 16:5523850-5523872 CATGCTGCCCCAAGGACACCTGG - Intergenic
1133443353 16:5838950-5838972 TTTGCACCCCAGAGGACATTTGG + Intergenic
1133744775 16:8677707-8677729 TTTGCTCCCCAGGGCACATCTGG - Intronic
1137643640 16:50055874-50055896 TTTGCCTCCCAGAGGACATTTGG + Intergenic
1138536082 16:57660953-57660975 CATGCTGGCCAGGGGACACCTGG + Intronic
1139133450 16:64173833-64173855 TTTGCTCCCCAGGGGATACTTGG - Intergenic
1139956500 16:70695747-70695769 TTTGGCGCACAAAGGACACCAGG + Intronic
1141474999 16:84266949-84266971 TTTGCCGCCCAGGGGACAGCAGG + Intergenic
1143010286 17:3862280-3862302 TTTCCTGTTCAGGGGACACCAGG + Intronic
1143694946 17:8606995-8607017 TTTGCTGCCCACAGGACAAAAGG + Intronic
1144465635 17:15494780-15494802 TTTGCCCCCCAGGGGACATCTGG + Intronic
1146675440 17:34770410-34770432 TTTGCTCCCCAGGGAACACTTGG + Intergenic
1151360954 17:73588580-73588602 TTTGCCCCCCAGGGGACATCTGG + Intronic
1151614680 17:75201882-75201904 TTTGCCCCCTAGAGGACACTGGG + Intergenic
1151862804 17:76778088-76778110 TATCCTGCCCCAAGGACACCTGG - Intronic
1152003281 17:77660899-77660921 CTGGCTTCCCAGAGGACATCTGG - Intergenic
1152250636 17:79210866-79210888 CTCGCTGCCTAGAGGAGACCAGG - Intronic
1153643405 18:7174528-7174550 CATGGTGCCCAGATGACACCTGG + Intergenic
1154131201 18:11738356-11738378 ATTGCTGCCCACAGCAGACCTGG - Intronic
1155267423 18:24107104-24107126 TTTACTGGGCAGAGGATACCTGG + Intronic
1156934670 18:42689373-42689395 TATGCTGCCAAAAGCACACCAGG + Intergenic
1157676724 18:49574040-49574062 TTTGCCCCCCAGGGGACATCTGG - Intronic
1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG + Intronic
1161372014 19:3917852-3917874 CCTGCTGCCCAGAAGTCACCGGG - Intronic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1161605952 19:5215042-5215064 TTTGCTGCCCAGGGGACATCTGG - Intronic
1161984341 19:7645458-7645480 TCTGGGGCCCAGAGGACACTGGG + Intronic
1163289976 19:16372896-16372918 TTGGCTGCCCAGAGGACAGAAGG + Intronic
1164083891 19:21884173-21884195 TTTGCTGCCGAGAGGGGTCCGGG + Intergenic
1165526861 19:36363527-36363549 TTTGCTCCCCAAAAGACATCCGG + Intronic
1167216035 19:48165284-48165306 TTTGCTCCCCAGGGAACATCTGG - Intronic
924986175 2:271972-271994 TTTCCTGCCCAGAGGAGTTCAGG - Intronic
925962405 2:9030023-9030045 TTTACTGCCCAGAGTTGACCCGG - Intergenic
926280064 2:11438791-11438813 TTTGTTCCCCAGAGGACACTGGG - Intergenic
926649223 2:15323576-15323598 TCAGCCGCCCAGAGCACACCTGG - Intronic
926689430 2:15722994-15723016 TTCTCTCCCCAGAGGACATCTGG - Intronic
926847752 2:17160755-17160777 CCTGCTGCCAAGAAGACACCTGG + Intergenic
927410107 2:22815304-22815326 TTTGCTCCTCAGAGGACATTAGG - Intergenic
927579208 2:24226239-24226261 TTTGCAGCCCAGAGCAGAACAGG - Intronic
928607184 2:32953695-32953717 TTTGCTGCCCAGTGAACCCTGGG + Intronic
929193517 2:39162368-39162390 TTGGGTGACCAGAGGACAACAGG - Intergenic
929535785 2:42783501-42783523 TTTGCTGCCCGGGGGTCAGCTGG - Intronic
931196838 2:60059732-60059754 TTTGTTCCTCAGAGGACATCTGG - Intergenic
932690336 2:73907722-73907744 TTTGCTTCCCAAAGGACATTTGG + Intronic
935788801 2:106571947-106571969 ACTGCTGCCCACAGGATACCAGG - Intergenic
936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG + Intergenic
936281014 2:111139776-111139798 TTGGTTTCCCAGAGGACACTGGG - Intronic
936489628 2:112958938-112958960 TTTGCTCCCCAGGGGACATTTGG + Intergenic
937159837 2:119749897-119749919 TTTGCACACCAGAGGACACCTGG + Intergenic
937968977 2:127535512-127535534 CATGCTGCCCGGAGGCCACCAGG - Intergenic
941711823 2:168722806-168722828 ATTTCTGTCCAGAGGACATCTGG + Intronic
942187868 2:173441487-173441509 ATTGCTGCCCAGAGTACAATGGG + Intergenic
942600572 2:177636816-177636838 GCTGCTCCCCAGAGGACATCTGG - Intronic
943046882 2:182870354-182870376 TATGATAGCCAGAGGACACCTGG + Intergenic
943760686 2:191605239-191605261 TTTGCCTCCCAGAGGACATTTGG - Intergenic
943890504 2:193280017-193280039 TTTGCTGCTCAGAGAACTCGTGG + Intergenic
944951213 2:204751392-204751414 TCTCCTGCCCAGAGGGCCCCAGG - Intronic
945055908 2:205868841-205868863 TGAGCTGTACAGAGGACACCAGG + Intergenic
945608176 2:211963145-211963167 TTTGCTTTCCAGAAGACATCTGG + Intronic
945778175 2:214133316-214133338 TTTTCTTCCCAGAGGACTTCTGG - Intronic
945939457 2:215933529-215933551 TTTGCTCCCCAGGGGACATTTGG - Intergenic
946189661 2:218001747-218001769 TTCTTTGCCCAGAGGACACCTGG + Intronic
947134431 2:226963117-226963139 TTTGCTCCCCAGGAGACAACTGG - Intronic
947740903 2:232484429-232484451 TTTTCTGCCCAGCGGTCACTAGG - Intronic
1169841067 20:9938289-9938311 TTTGTTTCCCAGAGGACACCTGG + Intergenic
1171279726 20:23885799-23885821 TATGCTTCCCAGAGCACACTTGG + Intergenic
1171982694 20:31638643-31638665 TTTGCTCCCCAGAGGAAGCTGGG - Intronic
1172689137 20:36778529-36778551 AGTGCTGCCCAGGAGACACCAGG - Exonic
1173008335 20:39157968-39157990 TGTGCTGCACAGAGCACACCTGG - Intergenic
1173149244 20:40551467-40551489 ACTGCTGCCCAGAGAACACATGG - Intergenic
1173309081 20:41880457-41880479 TTTTCTCCCTAGAGGAGACCAGG + Intergenic
1173332496 20:42087028-42087050 TTTGTTTCCCAGAGGGCATCTGG + Intronic
1173863949 20:46302399-46302421 TTTGCCCCCCAGAGGACTCTTGG - Intronic
1173948260 20:46968747-46968769 TTTGCTGCCCAGAGGACACCTGG - Intronic
1174082013 20:47977197-47977219 TTTGCCCCCCAGAGGACATTTGG - Intergenic
1174106325 20:48165104-48165126 TTTGCTTCCCAAAGGACAGAAGG - Intergenic
1174134467 20:48369606-48369628 TTTGCCCCCCAGAGGACATTTGG + Intergenic
1174314438 20:49687056-49687078 TTTGCTTCCCAGGGGACATTTGG + Intronic
1174431999 20:50477160-50477182 TTTGTCCCCCAGAGGACATCTGG + Intergenic
1175212004 20:57365052-57365074 GTTGCTGCTGAGAGGAGACCTGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176002834 20:62840634-62840656 ATTGGGGCCCAGGGGACACCGGG + Exonic
1176725647 21:10430276-10430298 TTTGCTGCCCAAGGGACATCTGG - Intergenic
1177151293 21:17457833-17457855 TTTGCCCCCCAGAGGACATTTGG - Intergenic
1177846046 21:26288295-26288317 TTTGCTTGCCAGGGGACATCTGG + Intergenic
1178581772 21:33844457-33844479 TTTGCTGGCAAGAGAACACAAGG - Intronic
1179234015 21:39529184-39529206 TCTGCAGCCCAGAGGCCCCCAGG + Intergenic
1180643194 22:17316352-17316374 TTTGTTGCCCAGATGGCATCTGG + Intergenic
1181449741 22:23011592-23011614 TTTTCTTCCCAGAGGGCACTTGG + Intergenic
1181884208 22:26006852-26006874 TTTGATGCCCGGAGGAATCCCGG + Intronic
1182038335 22:27216707-27216729 TAGGCTGCACAGAGCACACCTGG - Intergenic
1182246075 22:28958668-28958690 TTTGGAGTACAGAGGACACCAGG + Intronic
1182298828 22:29326936-29326958 TGTGCTGCCCTGGGGACCCCAGG - Intergenic
1183251373 22:36732762-36732784 TTTTCTGCCCAGTGGACTCTTGG + Intergenic
1183265760 22:36824167-36824189 AGTGCTGCCCAGAGGAACCCTGG + Intergenic
1183296226 22:37031084-37031106 TTTGCCCCCCAGGGGACATCCGG - Intergenic
1183307966 22:37093060-37093082 ATTCCTGCGCTGAGGACACCAGG - Intronic
1184524011 22:45010757-45010779 TTTGCTGCCAACAGGGCACCCGG - Intergenic
1184998192 22:48225907-48225929 TTTGCTCCCCAGAAGACTCGTGG - Intergenic
1185234556 22:49704553-49704575 CTGGCTGCCCAGAGGCCACAGGG - Intergenic
951896480 3:27614498-27614520 TTTGCTTCCCAGAGGACATTTGG + Intergenic
953209053 3:40858244-40858266 GTTGCTCCCCTGAGGACACAGGG + Intergenic
954868573 3:53750006-53750028 TTTGCCCCCCAAAGGACACTTGG - Intronic
954955883 3:54517956-54517978 TTTGCAGCCCTCAGGACCCCTGG + Intronic
955206949 3:56904613-56904635 TTGGCTGCACAGAAGACAGCTGG + Intronic
955641761 3:61093317-61093339 TTTGCTCACCAGAGGACATTTGG + Intronic
956018688 3:64911066-64911088 TTTGCTTCCCAGGAGACACTTGG - Intergenic
956174820 3:66462974-66462996 TTTGCCCCCCAGAGGACACTTGG + Intronic
956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG + Intergenic
956704060 3:71984107-71984129 TGTGATGCCCAGAGGAGACTGGG + Intergenic
956729876 3:72186849-72186871 TTTGCACCCCAGGGGACACTTGG + Intergenic
956852869 3:73246878-73246900 TTTGCCACCCAGGAGACACCTGG - Intergenic
956916228 3:73874477-73874499 TTTGCCCCCCAGAGGTCATCTGG + Intergenic
957819870 3:85358237-85358259 TTTGCTGTCCAGGGGACATTTGG - Intronic
960562235 3:119097415-119097437 TTTGCTCCCCAGAGGAAAAATGG - Intronic
961180025 3:124869143-124869165 GTTGCTGCCCAGTAGACAGCCGG - Intronic
961642145 3:128371470-128371492 TTTGGTCCCCAGGGGACACTTGG - Intronic
961975732 3:131023044-131023066 TTTGTCCCCCAGAGGACATCTGG - Intronic
962572627 3:136726373-136726395 TTTGCTTCCCAGGGGACATTTGG - Intronic
963205466 3:142629930-142629952 TATGATCCCCAGAGGACATCTGG - Intronic
963850771 3:150208466-150208488 TTTGCCTCCCAGAGGACATTAGG + Intergenic
964742604 3:159983307-159983329 CTTGCTCCCCAGGGGACACTTGG - Intergenic
966205910 3:177406259-177406281 TTTGCTCTCCTGAGGACACAGGG - Intergenic
966944965 3:184771344-184771366 TTTGCTTCCCAGAGGGCGTCTGG + Intergenic
967718156 3:192787799-192787821 TTTGCTCCCCAGAGGACATATGG + Intergenic
968564686 4:1305244-1305266 CTTGCTCCCCAGGGGACACCTGG - Intronic
968627196 4:1631291-1631313 TTTGCTGCCCACAGCAGGCCTGG - Intronic
969363921 4:6682959-6682981 TCTGCTGCCCACAGCAGACCTGG - Intergenic
970105377 4:12576872-12576894 TTTGTCCCCCAGAGGACATCTGG - Intergenic
970476470 4:16428896-16428918 TTTGCTCCCCAGGGGACATTTGG + Intergenic
970863592 4:20733809-20733831 TTTCTTGCACAGAGGACACCTGG - Intronic
970944359 4:21672683-21672705 TTTGTTACACAAAGGACACCTGG - Intronic
971144287 4:23960218-23960240 TTTGTTGCTCAAGGGACACCTGG + Intergenic
971381157 4:26099194-26099216 TTTCCTGTACAGAGGGCACCAGG - Intergenic
973590182 4:52433295-52433317 TTTGCTCCCAAGAGGACATTTGG - Intergenic
975851704 4:78579391-78579413 TTTGCTCCCCAGGGGACATTTGG + Intronic
976772277 4:88665919-88665941 TTTGCTCCCCAAAGGACATTTGG + Intronic
979074886 4:116258851-116258873 TTTGCCCCTCAGAGGACATCTGG - Intergenic
979891692 4:126104989-126105011 TTTAATGCCAACAGGACACCAGG - Intergenic
983646832 4:170000033-170000055 TTTTCTCCACAGAGGACACGTGG - Intronic
985617316 5:931221-931243 TTTGCTGACTAGAGGTCACACGG + Intergenic
987006499 5:13715804-13715826 TTTGCCCCCCAGAGGACATTTGG + Intronic
987200727 5:15574975-15574997 TTTGCCTCCCAGGGGACATCTGG + Intronic
987217025 5:15748032-15748054 TTTGCTCCCCAGGGAACACCTGG + Intronic
987217034 5:15748091-15748113 TTTGCTCCCCAGGGAACACCTGG + Intronic
988987555 5:36635696-36635718 TTTGCTGCCCCGTGGAATCCAGG - Intronic
990361767 5:55027956-55027978 TTTTCTGCCCACAGGGTACCTGG - Intronic
993454443 5:88111306-88111328 TTAGCTTCTCAAAGGACACCTGG + Intergenic
994043704 5:95285006-95285028 GGTGCTGCCCAGAGGGCGCCGGG - Intergenic
995131593 5:108636290-108636312 TTTGCTGCCCAGGCAACTCCTGG + Intergenic
995574661 5:113516641-113516663 TTTGCTCTCCAGAGGACATTTGG - Intronic
997713465 5:136025433-136025455 TCTGCAGCCCAGCTGACACCAGG - Intergenic
999343286 5:150792287-150792309 TTCCCTGCCCAGAGGGCACAAGG - Intronic
1000382594 5:160642472-160642494 TTTACTCCCCAGAGGACATTTGG + Intronic
1001152176 5:169241544-169241566 TTTGCCTTCCAGAGGACACTTGG - Intronic
1001632590 5:173187218-173187240 TAGGCTGCCCAGAGGACTCAAGG - Intergenic
1001744050 5:174076714-174076736 TTTGTTTCTCAGAGGACACTTGG + Intronic
1001746101 5:174093547-174093569 AATTCTGCCCAGATGACACCTGG - Intronic
1002051215 5:176572660-176572682 TTTGCTGCCCAGTGACCATCAGG - Intronic
1002618924 5:180472735-180472757 TTTTATACCCAGAGGACAGCTGG + Intergenic
1002785889 6:399768-399790 TTTGCTGCTCAGAGGGGAGCTGG + Intronic
1002985914 6:2190866-2190888 TTTGCTGCCTTGGGGACACGGGG - Intronic
1003034111 6:2628250-2628272 TTGTCTGCCCAGGGGACATCTGG + Intronic
1003148078 6:3525842-3525864 TGGGCTGCCCAGAGGACAGGAGG - Intergenic
1004029691 6:11854483-11854505 TTTGCTTCCCAGGGGACATTGGG + Intergenic
1004162741 6:13229331-13229353 TTTGCTCCCCAGGGAACACCTGG - Intronic
1005354377 6:24968529-24968551 CTTGCTCCCCAGGGGACATCTGG + Intronic
1005993571 6:30918513-30918535 CTGGGTGCCCAGAGGACACTGGG - Intronic
1006655014 6:35583578-35583600 TTTGCCCCCCAGGGAACACCTGG + Intronic
1007471445 6:42093240-42093262 TTTGCTTCCCAGAGGATATTTGG - Intergenic
1007688068 6:43679157-43679179 TTTGCTCCCCAGGGGACATCTGG + Intronic
1008008194 6:46434762-46434784 TTTGCCCCCCAGGGGACATCTGG + Intronic
1008197032 6:48537128-48537150 TTTGCTCCCCAGAAGACATTTGG - Intergenic
1008814647 6:55550764-55550786 TTTGCACCCCAAGGGACACCCGG + Intronic
1009062917 6:58418818-58418840 TTTATTTCCCAGAGGACACTGGG - Intergenic
1009250597 6:61293365-61293387 TTTATTTCCCAGAGGACACTGGG - Intergenic
1009473312 6:64055976-64055998 TATGCTGCCCAGAGGCCCCTCGG + Intronic
1009955517 6:70448166-70448188 TTTCCTTTCCAGAGGACACTGGG - Intronic
1010911494 6:81563323-81563345 TTTTCTCCCCAGAGATCACCTGG - Intronic
1013739642 6:113267595-113267617 TTTCTTTCCCAGAGGACACTGGG - Intergenic
1020813374 7:12873536-12873558 TGTGCTACCCAGAGTACATCGGG - Intergenic
1021821815 7:24506078-24506100 TGTGCTGCCCAGGGGACATTTGG + Intergenic
1022128390 7:27379547-27379569 TTTGCTGCCCAAAGTACACTGGG - Intergenic
1022582004 7:31564821-31564843 ATTGCTGCCCTGAAGACACCTGG + Intronic
1024985665 7:55191429-55191451 TCTGCTGCCCAGTTGAGACCTGG - Intronic
1025157448 7:56621028-56621050 TTTCCAGCCCAGAGGACATGGGG - Intergenic
1026095352 7:67342203-67342225 TTTGCTTCCCAAAGGAAACCAGG - Intergenic
1029436880 7:100568561-100568583 TTGGCTTACCAGAGGTCACCTGG + Intergenic
1031007935 7:116495870-116495892 TTTGCCCCCCAGAGGACATTTGG + Intronic
1031159860 7:118153276-118153298 TTTGCCTCCCAGAGGACATTTGG - Intergenic
1031720381 7:125168025-125168047 CTTGCAACCCAGAGGACAACAGG - Intergenic
1033275920 7:139971560-139971582 TTTGCAGCCCAGATGACCTCTGG - Intronic
1034489230 7:151384290-151384312 TTTGCTGCCCAGATGGAATCAGG - Intronic
1034612219 7:152381296-152381318 TTTGCTCCCCAAGGGACATCTGG + Intronic
1035004566 7:155645221-155645243 TCTCCTACCCATAGGACACCAGG - Intronic
1035332843 7:158107549-158107571 TTGACTGCCCAGGGGCCACCAGG + Intronic
1036371441 8:8166077-8166099 TTTGCCCCCCAGAGAACACGTGG - Intergenic
1036410391 8:8494445-8494467 TTTGTCCCCCAGAGGACACTTGG - Intergenic
1036879462 8:12499567-12499589 TTTGCCCCCCAGAGAACACGTGG + Intergenic
1042207799 8:66346415-66346437 TTGGCTTCCCAGAGGACCCAGGG + Intergenic
1044263725 8:90158253-90158275 TTTGCTTCCCAGAGGACATTTGG - Intergenic
1045496978 8:102717319-102717341 TTTGCTGTCCAGGGGACACTTGG - Intergenic
1045690342 8:104753824-104753846 TTTGCTTCCCAGGGGACATTTGG + Intronic
1045759539 8:105587899-105587921 TTTGCTCCCCAAGGGACACCTGG - Intronic
1046299524 8:112269071-112269093 TTTGCTTCCCAGGGGACATTTGG - Intronic
1046635908 8:116675537-116675559 ATTACTCCCCAGAGGACATCAGG - Intronic
1047812872 8:128429413-128429435 TTGGGTACCCACAGGACACCGGG + Intergenic
1048136062 8:131747509-131747531 TTTGCTGCCTAAAGGGCACACGG - Intergenic
1049096754 8:140552915-140552937 TTTGCCCCCCAGGGGACATCTGG - Intronic
1049435991 8:142586497-142586519 TTGGGTGCCCAGAGGACAGTGGG + Intergenic
1049463394 8:142740243-142740265 TGTGCAGCCCAGGAGACACCAGG + Intergenic
1049527982 8:143138708-143138730 TTTTGTCCCCAGAGGACATCTGG + Intergenic
1049609919 8:143550119-143550141 TTTGAGGCCCAGAGCACCCCTGG - Intergenic
1049618640 8:143587996-143588018 TTTGTTACCGAGAGGACACTTGG - Intronic
1049642644 8:143722379-143722401 TCTGCTCCCCCGAGGAGACCCGG - Exonic
1049880974 8:145062894-145062916 TTTGCTGCCGAGAGGGGTCCAGG - Intergenic
1050778465 9:9299298-9299320 TTTGCCCCCCAGAGGACATTTGG + Intronic
1052789806 9:32864799-32864821 ACTGGTGCCCAGAGGAGACCTGG - Intergenic
1058456471 9:105142440-105142462 ATTGCTGGCCACAGGTCACCTGG - Intergenic
1059168789 9:112104652-112104674 GCTGCTGCCCAAAGGACACTGGG + Intronic
1059197358 9:112382508-112382530 TTTGATCCCCAGAGGACATTTGG + Intronic
1060302193 9:122381304-122381326 CTTGCTGCCCTGGGGACATCTGG - Intronic
1060728015 9:126018647-126018669 TTTGCCCCCCAGGGGACACTTGG - Intergenic
1061222796 9:129262045-129262067 CTTGCTGTCCAGAGGACAGAGGG + Intergenic
1061678821 9:132232605-132232627 TATCCTTCCCAGAGGGCACCAGG + Intronic
1061701327 9:132418195-132418217 TTTGCTCCCCAGGGAACACTGGG + Intronic
1062265442 9:135684723-135684745 TTTCCTCCCCAGAGGGGACCAGG - Intergenic
1186199957 X:7147502-7147524 TTTGCAGCCCTGAGGGCATCTGG - Intronic
1186430551 X:9500838-9500860 TTTGTTCCCCAGGGGACACTCGG + Intronic
1186633872 X:11380872-11380894 TTTGACTCCCAGAGGACACTTGG - Intronic
1186766798 X:12778770-12778792 ATTGCTGCTCAGGGGCCACCAGG - Intergenic
1186867359 X:13734114-13734136 CTTGCTTCCAAGAGGACATCTGG + Exonic
1187015047 X:15318310-15318332 TTTGTTTCCCAGGGGACATCTGG - Intergenic
1187679966 X:21758029-21758051 ATCGCAGCTCAGAGGACACCGGG - Exonic
1187737736 X:22321939-22321961 TTTGCTGCCAAGGGGACATTTGG + Intergenic
1188024352 X:25193305-25193327 TTTGCACCCCAGGGGACATCCGG - Intergenic
1188338003 X:28961815-28961837 TTTGCTTCCCAGGAGACAACTGG - Intronic
1188425914 X:30046652-30046674 TTTGCCTCCCAGAGGACATTTGG + Intergenic
1189215589 X:39320362-39320384 TCTGCTGCCCAGCTGGCACCAGG - Intergenic
1189993281 X:46614579-46614601 TTTGCTTCCCAGGGGACATTTGG - Intronic
1193871795 X:86807035-86807057 TTTGTTGCCCAGAGGACATATGG - Intronic
1196059462 X:111391708-111391730 TTTGCTGTCCAGGGGACACTTGG - Intronic
1196124806 X:112085679-112085701 TTTGCTCCCCAGTGGACATTTGG - Intergenic
1196216506 X:113058442-113058464 TTTGCTCCCCAGGGAACACTTGG - Intergenic
1196754414 X:119145410-119145432 TTTGCTCCCCAGGGGACATTGGG - Intronic
1201788242 Y:17808639-17808661 CTTGCTTCCAAGAGGACATCTGG + Intergenic
1201813311 Y:18097349-18097371 CTTGCTTCCAAGAGGACATCTGG - Intergenic