ID: 1173948381

View in Genome Browser
Species Human (GRCh38)
Location 20:46969777-46969799
Sequence CTGGATGTTAAACCTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173948375_1173948381 27 Left 1173948375 20:46969727-46969749 CCACAATGCACTCTTTGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 81
Right 1173948381 20:46969777-46969799 CTGGATGTTAAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 156
1173948372_1173948381 29 Left 1173948372 20:46969725-46969747 CCCCACAATGCACTCTTTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1173948381 20:46969777-46969799 CTGGATGTTAAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 156
1173948374_1173948381 28 Left 1173948374 20:46969726-46969748 CCCACAATGCACTCTTTGGGGGT 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1173948381 20:46969777-46969799 CTGGATGTTAAACCTGGGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173948381 Original CRISPR CTGGATGTTAAACCTGGGCA AGG Intronic
900437420 1:2637917-2637939 CTGGATGCTGAAGCTTGGCATGG + Intronic
902172761 1:14626498-14626520 CGGGATGGTAACCCCGGGCAAGG - Intronic
904207737 1:28865629-28865651 CTGGATGTGAGTGCTGGGCATGG - Intergenic
906151945 1:43592622-43592644 CTGCCTGTTACACCTGGGCTGGG + Intronic
906702932 1:47872803-47872825 CTGGGAGTTTGACCTGGGCATGG + Intronic
907374864 1:54028216-54028238 CTGGATGGTAAACCTAGGACTGG - Intergenic
912504404 1:110146325-110146347 CTGTGTGTTAAAGTTGGGCATGG + Intergenic
912860997 1:113213837-113213859 CTGGATGAGAATCCTGGGCCTGG - Intergenic
915997304 1:160576275-160576297 TTGGATGTTAAACATGGTCATGG - Intronic
916022875 1:160809308-160809330 CAGGATTTAAAAGCTGGGCATGG - Intronic
917437449 1:175035662-175035684 CTGGGTGTTGGTCCTGGGCAGGG - Intergenic
918268501 1:182871513-182871535 CTGTAGGTTAAACATGGGTATGG - Intronic
919738383 1:200967942-200967964 CAGGAAGTGACACCTGGGCATGG - Intergenic
923441581 1:234025706-234025728 CTGGATGTTAGACCTTTGTAGGG + Intronic
1070431647 10:76345630-76345652 ATGGATGGGAAACCTAGGCATGG + Intronic
1070979495 10:80632947-80632969 CTTGCTGTAAATCCTGGGCAAGG + Intronic
1071535124 10:86422175-86422197 CTGGATGTTAATCATGGGGGAGG - Intergenic
1076442955 10:130492806-130492828 CTGGGTGTGGACCCTGGGCATGG + Intergenic
1078823886 11:14907789-14907811 CTGGCTGTTTATCCTGGGGAGGG + Intronic
1079329110 11:19519610-19519632 CTGAATGTCAAACCTGGAAAAGG - Intronic
1079837605 11:25353351-25353373 TTGTATGTTAAACATGGGCCAGG + Intergenic
1080548215 11:33342967-33342989 CTAGATGTTAAAGCTTAGCAAGG - Intronic
1081127607 11:39340733-39340755 CTGGATGTTGTACCTGGGGGTGG - Intergenic
1083228412 11:61299575-61299597 CTGGGTGTAAAACCTGGAGATGG - Exonic
1088473046 11:110207309-110207331 CTGAATGTGAAACCTGAGGAGGG + Intronic
1088976912 11:114823832-114823854 CTGGATGTGGAACCTGCACATGG - Intergenic
1090613048 11:128488979-128489001 CTGCTTGTTCAACCAGGGCATGG + Intronic
1090925894 11:131250198-131250220 CTGGCTGTTAGACCTGGGGAGGG - Intergenic
1094288303 12:28818059-28818081 CTGGACGTTATACCTGGGGGTGG + Intergenic
1095092269 12:38118397-38118419 CAAGAATTTAAACCTGGGCAGGG - Intergenic
1095467590 12:42504240-42504262 CTGGATGTGAGTCCTGGGCATGG + Intronic
1101318806 12:103654308-103654330 ATATATGCTAAACCTGGGCAAGG - Intronic
1102542920 12:113635254-113635276 CAGGATGTCAAAACAGGGCAAGG + Intergenic
1102671348 12:114621789-114621811 ATAGATGTACAACCTGGGCAGGG - Intergenic
1103543082 12:121679667-121679689 CTGGATGTTCAGCCTTGGCAGGG + Intergenic
1104434076 12:128742084-128742106 CTGGCTCTTACACGTGGGCACGG + Intergenic
1104717673 12:131026732-131026754 CTAGTTGTCAAACCTGGGGAGGG - Intronic
1106255287 13:28016903-28016925 CTGGATGTTCACCCTGGACAAGG + Intronic
1107594435 13:41947842-41947864 CTGGAGGTTGAACCTGGGAGGGG + Intronic
1110944547 13:81396303-81396325 CTGCATGTTAGATATGGGCAAGG + Intergenic
1112958649 13:105093224-105093246 CTTCATGTTAAAACTGGGCATGG - Intergenic
1118298288 14:64590798-64590820 CTGGATATTGAATCTGGGAAAGG - Intergenic
1118939277 14:70317597-70317619 GTGGTTGATATACCTGGGCAAGG + Intergenic
1118989498 14:70784934-70784956 CTGGACATTAAACCTGGTCTTGG - Intronic
1119220199 14:72900320-72900342 CTGGATGATGCACCTGGGAATGG + Intergenic
1119290163 14:73489325-73489347 GTGGATGTTAGACATGGGTAAGG + Intronic
1121663714 14:95655511-95655533 CTGGATGTTGAACTTGTGAAAGG + Intergenic
1123768001 15:23500862-23500884 ATAGATGATAAACCTTGGCAGGG + Intergenic
1125210287 15:37206901-37206923 CTAGATGGTAAACCTGGCCAGGG - Intergenic
1128871245 15:71156881-71156903 CTGAATGGAAAACCTGGCCAAGG + Intronic
1129034811 15:72642559-72642581 CTGGAGGGTAAAACTGGGCCTGG - Intergenic
1129076341 15:72999579-72999601 CTAGATGTGAGGCCTGGGCAAGG + Intergenic
1129215071 15:74094657-74094679 CTGGAGGGTAAAACTGGGCCTGG + Intergenic
1129347487 15:74932436-74932458 ATGTATGTTAAGGCTGGGCATGG - Intronic
1129390299 15:75216959-75216981 CTGGAGGGTAAAACTGGGCCTGG - Intergenic
1129732213 15:77939003-77939025 CTGGAGGGTAAAACTGGGCCTGG + Intergenic
1137749208 16:50846467-50846489 CTGCATGTTATATCTGGGCTGGG - Intergenic
1138387475 16:56645702-56645724 CTGGCTGTGTGACCTGGGCAAGG + Intronic
1138528725 16:57623351-57623373 ATGCAGGTTAAACATGGGCAGGG + Intronic
1140420212 16:74813193-74813215 CTGGCTGTGACACCTGGGCTGGG + Intergenic
1140494407 16:75371232-75371254 CTGGTTGTATAACCTGGGCAAGG - Intronic
1140822742 16:78678508-78678530 CTGGAAGGAAAAGCTGGGCAAGG + Intronic
1140906644 16:79415053-79415075 TTTGAGGTTAAGCCTGGGCATGG - Intergenic
1142701940 17:1667966-1667988 TTGCATGATAAAGCTGGGCATGG - Intronic
1148101771 17:45096664-45096686 CTGGATATTAAACGTGGCCTGGG - Intronic
1150695758 17:67403719-67403741 CTGGGTGTAAACCCTGGGCTTGG + Intronic
1151934288 17:77252645-77252667 CTGGGTGCTAAACCTAAGCAGGG - Intergenic
1152737259 17:82003652-82003674 TTGGATGTAAAATTTGGGCATGG + Intronic
1160852556 19:1199888-1199910 CTGGAGTGTAGACCTGGGCAGGG + Intronic
1161271923 19:3394577-3394599 CTGGATGTCACACGTGGCCAGGG + Intronic
1164517146 19:28946243-28946265 CTGGTCCTTAATCCTGGGCAGGG + Intergenic
1165785211 19:38457728-38457750 CTGGTTGTTAACCCTGGGGTGGG - Intronic
1165948538 19:39459458-39459480 CTGGATGTGAAACCAGAGGAAGG + Intronic
1168431175 19:56282132-56282154 CTGGATGTTAATTCTGGGAAAGG - Intronic
1168564481 19:57411756-57411778 CAGGATGTTAAACCAGGACAAGG + Intronic
1168567360 19:57435963-57435985 CAGGATGTTGAACGGGGGCAGGG + Intronic
925147043 2:1588510-1588532 CTGGACGTGAGAGCTGGGCAGGG + Intergenic
925288440 2:2730713-2730735 CAGGAAGTTAAAGCCGGGCAAGG - Intergenic
927229302 2:20804200-20804222 TAGGATGTTCAATCTGGGCAGGG - Intronic
929767237 2:44855828-44855850 CTTGGTGCTAAACCTGGACAAGG + Intergenic
929858466 2:45654874-45654896 CTGAATGTTAAGACTGGGAAAGG - Intronic
931224207 2:60315679-60315701 CTTCATGTTAAACCTGTGCAGGG + Intergenic
932110246 2:68992747-68992769 CTGGATGTAAAAGCAGGACAAGG - Intergenic
939051976 2:137318290-137318312 GTGGTTGTTAAACCTGGACTAGG - Intronic
940727257 2:157348119-157348141 CTTTAAGTTAACCCTGGGCAAGG - Intergenic
943724461 2:191238607-191238629 CTGAAGGTTTACCCTGGGCAGGG - Intergenic
944199197 2:197087600-197087622 CTCAATGATAAACCTGAGCAGGG + Intronic
945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG + Intergenic
946521351 2:220468261-220468283 CTGGAGGTTGTGCCTGGGCAAGG - Intergenic
947077327 2:226359569-226359591 TGGGATGTAAAACCTGGTCAAGG + Intergenic
948718974 2:239884160-239884182 CTGGCTGCTAACCCTGGCCACGG + Intergenic
1169909003 20:10631945-10631967 CTGGATGCTCAACCAGGGAAAGG + Intronic
1170891554 20:20380467-20380489 CCTGATGTTAAAAGTGGGCAGGG - Intergenic
1171534801 20:25877704-25877726 CTGAAGCTTAAACCTGGACAAGG + Intergenic
1173464976 20:43273594-43273616 ATGGGTGTCAACCCTGGGCACGG + Intergenic
1173780372 20:45751457-45751479 ATGAAAGGTAAACCTGGGCAAGG - Intronic
1173948381 20:46969777-46969799 CTGGATGTTAAACCTGGGCAAGG + Intronic
1175266342 20:57705795-57705817 CTGGCTGTCAAACCTGGGAGAGG + Intronic
1175909696 20:62398872-62398894 CTGGCTGTGTGACCTGGGCAAGG - Intronic
1179976544 21:44871446-44871468 CTTGAAGTTAAACCTGGATAGGG - Intronic
1180059350 21:45376598-45376620 CTGGATGGTGTCCCTGGGCAGGG - Intergenic
1183885750 22:40880498-40880520 CTAGATTACAAACCTGGGCAAGG + Intronic
1184577136 22:45379278-45379300 CTGAATGTTGAGGCTGGGCATGG - Intronic
951459458 3:22933679-22933701 TGGGATGTTTAACCTGAGCAAGG - Intergenic
953857108 3:46507884-46507906 CAGGATTTTAAACCAGGGCATGG - Intergenic
954790982 3:53133237-53133259 CTGGAAGTTAACACTTGGCAAGG + Intergenic
955062221 3:55503142-55503164 CTGGTTATTAAACGTGGTCAAGG + Intergenic
961462601 3:127061992-127062014 CTGGGTGTTGAACATGGGCAGGG + Intergenic
963288715 3:143464740-143464762 CTGGATGAGAAACTTGGGCTGGG + Intronic
964011823 3:151900655-151900677 CAGGATGTTTAGCCTGGGCTGGG + Intergenic
964118535 3:153160613-153160635 TCGGAGGGTAAACCTGGGCATGG - Intergenic
964258855 3:154811174-154811196 CTGGATAGCAAACCTGGTCAGGG - Intergenic
966821925 3:183931627-183931649 TTGAATGTTAAGCCTGGGCTGGG - Intronic
968223464 3:196956731-196956753 CTAGATGTTAAACCTGTCTATGG + Intronic
968321760 3:197775642-197775664 CTGGCTGTAAAACATGGTCAGGG + Intronic
971250643 4:24970722-24970744 CTGGATGTTGTACCTGGGGGTGG + Intronic
971330649 4:25678467-25678489 ATGTAAGTTAAACCCGGGCAGGG + Exonic
971542198 4:27833237-27833259 TAGGATGTTAAGGCTGGGCACGG + Intergenic
972492415 4:39600327-39600349 CTGGATGATTAGGCTGGGCACGG - Intronic
980733917 4:136857634-136857656 CTGCTTTTTAAACCTGGGTATGG + Intergenic
982186229 4:152803491-152803513 CTGGTTGTTATAGCTGGGAATGG - Intronic
984550039 4:181148710-181148732 CTGGGTGTCAGGCCTGGGCACGG + Intergenic
992136993 5:73756063-73756085 CTGGCTGTGAGACTTGGGCAAGG + Intronic
992872117 5:81017695-81017717 CTTGAAGTTAAACCTGCCCATGG + Intronic
993403438 5:87481931-87481953 CTAGATGTTATAGCTGGTCAAGG - Intergenic
993595153 5:89844924-89844946 CTGCATGTTACACCTGAGCATGG + Intergenic
994504313 5:100621894-100621916 CTGGCTGTTACACCTGAGCTGGG + Intergenic
995484980 5:112631062-112631084 CTTGATGTTAACCTTGGCCATGG + Intergenic
999059688 5:148620091-148620113 CTGGATGTTCACCTGGGGCAAGG + Intronic
999824169 5:155258251-155258273 CTGAATCTTAGACCTGGGCGAGG + Intergenic
1004409762 6:15370036-15370058 CTGGATGTTAGACACTGGCAGGG + Intronic
1005354592 6:24970076-24970098 CTGGATGGGAAGCCTGGGAAAGG + Intronic
1006031339 6:31178875-31178897 CAGGAAGTTAAAAATGGGCAGGG - Intronic
1006374785 6:33665825-33665847 CTGGATGACAAACCTGGGTGAGG - Exonic
1012131720 6:95501332-95501354 CTGGACTTTAAAACTGGGTAAGG - Intergenic
1013333496 6:109130784-109130806 CTGGATATGAAACCTGGAGAAGG - Intronic
1013505422 6:110795259-110795281 CAGGAAGTTTAAGCTGGGCATGG - Intronic
1015746094 6:136511353-136511375 CTGGATTTTTACCCTGGGCTTGG - Intronic
1018640024 6:165897322-165897344 CTGGATGAAACACCTGGGGAGGG + Intronic
1019015340 6:168875990-168876012 CTGGATCTTCCATCTGGGCAGGG + Intergenic
1019720435 7:2567364-2567386 CTGGACGTGAATCCTGAGCAGGG + Intronic
1020658639 7:10956409-10956431 CTTGATTTTAAAACTGTGCACGG + Intergenic
1021806388 7:24360952-24360974 GTGAATTTTAAACATGGGCATGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023684487 7:42720744-42720766 CTGGCTGTGTGACCTGGGCAAGG - Intergenic
1023745450 7:43318825-43318847 CTGGAGGGACAACCTGGGCAAGG - Intronic
1027684474 7:81265059-81265081 CTGGATGTTGTACCTGGGGGTGG - Intergenic
1029481665 7:100817176-100817198 CTGGATGGTGAGCCTGGGGAAGG - Exonic
1030200375 7:106896858-106896880 CTGTATGTCAAGGCTGGGCAGGG - Intronic
1033243286 7:139698816-139698838 CTGGGTGTTAGTCCTGGTCAAGG - Intronic
1034857057 7:154560591-154560613 GTGAATTTTAAAGCTGGGCATGG + Intronic
1041289241 8:56293111-56293133 CTGGAGGGTAAACCTTTGCATGG + Intergenic
1043093283 8:75931415-75931437 CTGGATGTTAAACCTTTGTCAGG - Intergenic
1043383226 8:79724643-79724665 CTGGATCTTAAAAATGGGCTTGG + Intergenic
1044085240 8:87935610-87935632 TTGAATGTTATACCTGGGCTAGG + Intergenic
1046584532 8:116134911-116134933 CTGGCAGTTAAAACAGGGCAAGG + Intergenic
1048215184 8:132487451-132487473 CTGGTTATTAAACCTGTGCAGGG - Intergenic
1048345934 8:133574501-133574523 CTGAAGGGTTAACCTGGGCAAGG + Intergenic
1050635725 9:7610311-7610333 CTGGAAGCTTATCCTGGGCAGGG + Intergenic
1052125114 9:24765157-24765179 CAGGAAGTTCAAACTGGGCAGGG - Intergenic
1053250044 9:36566786-36566808 TTGGATGTAAAATCTGTGCATGG + Intergenic
1055307342 9:74943326-74943348 GTGGATGTTACACCAGGGAAAGG + Intergenic
1055838279 9:80471716-80471738 TTGAATCTTAAACCTGGCCATGG - Intergenic
1056245692 9:84692755-84692777 CTGTATGTAAACCCTGGGCGCGG - Intronic
1056958593 9:91102098-91102120 CTTGATTTTAAACCTGGGAGTGG + Intergenic
1060007660 9:120014817-120014839 GTGGATGTTAAGGCTTGGCATGG - Intergenic
1060294534 9:122334263-122334285 ATGGATGTAAAATATGGGCATGG + Intergenic
1060515904 9:124265690-124265712 CTGGTTGTGACACCTGGGCCTGG + Intronic
1061932717 9:133841560-133841582 CTGCATGTTGGCCCTGGGCAGGG - Intronic
1062304378 9:135894673-135894695 CTGCATGCTAAACCTGAACAAGG + Intronic
1187047168 X:15658399-15658421 CTGGAAGGAGAACCTGGGCATGG - Intronic
1190071472 X:47283447-47283469 CTGGAAATTAAGTCTGGGCAAGG + Intergenic