ID: 1173948744

View in Genome Browser
Species Human (GRCh38)
Location 20:46973430-46973452
Sequence GTCTCAACATGCCTTTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173948744_1173948750 22 Left 1173948744 20:46973430-46973452 CCCTTACAAAGGCATGTTGAGAC No data
Right 1173948750 20:46973475-46973497 ACTGTGTTCACGATGACACAAGG No data
1173948744_1173948749 -1 Left 1173948744 20:46973430-46973452 CCCTTACAAAGGCATGTTGAGAC No data
Right 1173948749 20:46973452-46973474 CAATTGGGGAAGATTGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173948744 Original CRISPR GTCTCAACATGCCTTTGTAA GGG (reversed) Intronic