ID: 1173950240

View in Genome Browser
Species Human (GRCh38)
Location 20:46987081-46987103
Sequence GCATCCTGCTTAACTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173950240 Original CRISPR GCATCCTGCTTAACTGATAC AGG Intronic
904334179 1:29786342-29786364 ACATCCTGCTTATCTGCTCCTGG + Intergenic
904809791 1:33155951-33155973 GCTTCCTGCTTTACTGAGAAAGG + Intronic
908315095 1:62924657-62924679 GGATCCTGCTCAGCTGAGACGGG - Intergenic
914421786 1:147535217-147535239 GGATCCTGATTAACTGATAAGGG - Intergenic
916199226 1:162254321-162254343 GCATCCTCCTAAACTGCTCCTGG - Intronic
922242903 1:223768092-223768114 GCAACCTGCTTATCTGACAAAGG - Intronic
923387002 1:233474602-233474624 GCATTCTGCTTAAAAGATAGAGG - Intergenic
923681807 1:236124511-236124533 GCCTCCTGATTAACTGGGACTGG + Intergenic
923682995 1:236134208-236134230 TCTTCTTGCCTAACTGATACAGG + Intergenic
1071204525 10:83258604-83258626 TCATCATGCATAACTAATACAGG - Intergenic
1077607444 11:3621640-3621662 GCATTCTGCTTCAGTGGTACAGG + Intergenic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1081413994 11:42791601-42791623 GCAGCCTGCTTATCTGACAAAGG + Intergenic
1082151042 11:48739113-48739135 GCAACCTGCTTATCTGACAAAGG + Intergenic
1082600035 11:55137930-55137952 GCAACCTGCTTATCTGACAAAGG + Intergenic
1083210988 11:61185905-61185927 GCACTCTGCTTAACAGACACTGG - Intergenic
1085522759 11:77147913-77147935 GCAACCTGCTTATCCGCTACCGG + Exonic
1088373232 11:109113968-109113990 GCATCCTGCTTAAATAATCTTGG + Intergenic
1091863243 12:3805928-3805950 GCAACCTGCTCAAGTGAAACAGG + Intronic
1091935490 12:4431437-4431459 GCATCCTGCTGATCTTATTCTGG + Intronic
1093839470 12:23879540-23879562 CCATGCTGCTTAACTAATACAGG - Intronic
1094077452 12:26492705-26492727 TCCTCCTGTTTAACTGAAACTGG - Intronic
1100864119 12:98837520-98837542 TTATCCTGTTTAAGTGATACTGG - Intronic
1100926830 12:99558293-99558315 GCATCCTGCTGCACTGCTGCTGG - Intronic
1107508285 13:41057520-41057542 GCCTCCTGAATAGCTGATACAGG + Intronic
1111634012 13:90880346-90880368 GCATCCTGAATAATTCATACTGG + Intergenic
1115470967 14:33768162-33768184 GCATTCTGCTTCACTGTTGCTGG + Intronic
1118520833 14:66583287-66583309 GCAACCTGCTTATCTGACAAAGG - Intronic
1140778702 16:78274459-78274481 GTGTCCTGCTTAACTCATTCAGG - Intronic
1149195718 17:54117635-54117657 TGATCTTGCGTAACTGATACAGG - Intergenic
1157547740 18:48558912-48558934 CCATCCTGGTAAACTCATACTGG + Intronic
1158021215 18:52844266-52844288 TCATCCTTCTTAACAGACACTGG - Intronic
926813332 2:16775854-16775876 GCAGCTTGCATAACTGATGCTGG - Intergenic
927176494 2:20412547-20412569 GCCTCTTCCTCAACTGATACAGG - Intergenic
928924717 2:36565837-36565859 GCATCCTGGTGAACAGAGACCGG - Intronic
929652986 2:43700771-43700793 GCCTCCTGAGTAGCTGATACAGG + Intronic
930708584 2:54528849-54528871 GCTTCCAGGTTAAATGATACTGG + Intronic
932658541 2:73631566-73631588 GCCTCTTCCTCAACTGATACAGG + Intergenic
940179547 2:150916911-150916933 GATGCCTGCTTAACTCATACGGG + Intergenic
941754058 2:169165720-169165742 GCATCATGCTCAAATGAGACAGG + Intronic
943562037 2:189475575-189475597 GCATCATGCTTTACAGTTACTGG + Intergenic
946798803 2:223386908-223386930 GCAACATGCTTAACTGACAAAGG - Intergenic
947985745 2:234446197-234446219 GCTTCTTGCTAAACTGATCCAGG + Intergenic
1169753802 20:9022726-9022748 GCTTCCAGCTGCACTGATACAGG - Intergenic
1173950240 20:46987081-46987103 GCATCCTGCTTAACTGATACAGG + Intronic
1179066193 21:38026903-38026925 GCATCCTGCTTTTCTGCTGCTGG + Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
970832962 4:20365222-20365244 GAACCATTCTTAACTGATACGGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
979323779 4:119354916-119354938 GCATCCTCTTTAAGTGATTCTGG + Intergenic
982170248 4:152655234-152655256 GCATCCTTCTTGGCTGAGACTGG + Intronic
982551721 4:156809473-156809495 TCACCCAGCTTAACTAATACAGG - Intronic
983241616 4:165239589-165239611 GCATCCTCTTTAAGTGATTCTGG + Intronic
983506220 4:168556525-168556547 GCATCCTGCTTCGCTGGTACAGG - Intronic
991526602 5:67565718-67565740 GCAACCTGCTTATCTGACAAAGG - Intergenic
995961945 5:117852243-117852265 GCAGCCTGCTTATCTGACAAAGG - Intergenic
1003055958 6:2820626-2820648 GTTTCCTGCTTAACTGGTGCTGG + Intergenic
1009028203 6:58025143-58025165 GCACCCTGCAAAACTGAAACCGG - Intergenic
1010320587 6:74504496-74504518 GCAGCCAGCACAACTGATACTGG - Intergenic
1012864178 6:104597640-104597662 GCATCCTGCCTGGCTGATCCAGG - Intergenic
1016794234 6:148100825-148100847 GCCTCCTGAGTAACTGGTACAGG + Intergenic
1021297084 7:18921321-18921343 GCAACCTGCTTATCTGACAAAGG + Intronic
1022319526 7:29275851-29275873 GCAACCTGCTGAACTCAAACTGG - Intronic
1024818101 7:53294743-53294765 TCCTCCTGCTTCACTGAAACAGG + Intergenic
1025755827 7:64339622-64339644 CCATCCTGCTCCACTGATATCGG + Intronic
1042259045 8:66837842-66837864 GCATCCTGATTCATTGATGCAGG + Intronic
1043376123 8:79651813-79651835 GCATCCTGCTTTGCTGAGCCTGG - Intronic
1049982615 9:918677-918699 GCCTCCTACTTAACTGTTAGTGG - Intronic
1050956334 9:11666163-11666185 GCAACCTACTTAACTGACAAAGG - Intergenic
1056489352 9:87089602-87089624 GCATCCACCTTAACTCATTCAGG - Intergenic
1197566527 X:128094667-128094689 GCATCCATCTTGGCTGATACTGG - Intergenic
1199728508 X:150607762-150607784 GCATAGTGCTTAACACATACTGG - Intronic