ID: 1173953381

View in Genome Browser
Species Human (GRCh38)
Location 20:47011158-47011180
Sequence TGGTGCACAACATTGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173953381 Original CRISPR TGGTGCACAACATTGAAGAT GGG Intronic
905138986 1:35825798-35825820 TGATGCTCAACATTGATGGTAGG + Exonic
907780811 1:57564127-57564149 TGCTGCAGAACAGTGAATATTGG - Intronic
909300200 1:74003128-74003150 AGGTGGACAAGATTGGAGATAGG - Intergenic
911167472 1:94736898-94736920 TGGTGCTCAACAGTGAAGAAGGG - Intergenic
911525367 1:98978348-98978370 TGGAGAAGAAGATTGAAGATGGG - Intronic
917188229 1:172386349-172386371 TGGTGCACAACACTGAGAGTGGG - Intronic
921429739 1:215051648-215051670 TGGGGCACAACATTCAGGCTTGG + Intronic
923937967 1:238785510-238785532 TTGTCCTCAAGATTGAAGATGGG - Intergenic
1070393277 10:75989529-75989551 TGATCCCCAACATTGGAGATGGG - Intronic
1070474102 10:76815302-76815324 TGGTGCAGAACAGTGGATATTGG + Intergenic
1076246625 10:128951850-128951872 TGGTACACAACATTGTAAATTGG + Intergenic
1077493861 11:2875487-2875509 ATGTGCACCACACTGAAGATGGG + Intergenic
1078323117 11:10354731-10354753 TGGGGCACAACAGTGGAGTTAGG + Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1085269122 11:75259796-75259818 TGGTGCCAAAGATAGAAGATAGG + Intergenic
1089873733 11:121699929-121699951 TGGTGCTCAGCTTGGAAGATTGG + Intergenic
1093709830 12:22317831-22317853 TGATGCACAACCTCTAAGATGGG - Intronic
1094200547 12:27791120-27791142 TGCTTCACAACATGTAAGATGGG - Intronic
1095625713 12:44312172-44312194 TGATGCACACCATAGATGATAGG - Intronic
1096091313 12:48903640-48903662 TGATGCCCAACATTGATTATGGG - Exonic
1098844823 12:75522734-75522756 TGCTGCAGAACAGTGAATATTGG + Intergenic
1099127895 12:78789009-78789031 TGGTGCACAACATGGAGAATGGG - Intergenic
1099627390 12:85091849-85091871 TGGTCCATAACCTGGAAGATGGG - Intronic
1105782887 13:23719930-23719952 TGGTGCACAGCCCTGAACATGGG + Intergenic
1105790950 13:23798576-23798598 TAATCCACAACATTGGAGATAGG + Intronic
1106121675 13:26864664-26864686 TGGTGAATCACATTGAAGAGCGG + Intergenic
1108037655 13:46308513-46308535 TGGTCCCCAATGTTGAAGATGGG + Intergenic
1109716144 13:66225205-66225227 TGATCCACAACATTGGAGGTGGG + Intergenic
1109838337 13:67888017-67888039 TAGAGAACAACTTTGAAGATGGG + Intergenic
1114849072 14:26360640-26360662 TGGTGCACAATATTTCTGATGGG - Intergenic
1117317105 14:54582195-54582217 TAGTTCACAACATTTTAGATAGG + Intronic
1118180662 14:63489358-63489380 TGGTGACCAACATTGAGTATGGG - Intronic
1118419523 14:65585694-65585716 TGTTAAACAACAGTGAAGATTGG + Intronic
1119119002 14:72055624-72055646 TGGAGCCCAGCATTGAACATAGG + Intronic
1119565097 14:75622116-75622138 TGGTACCCAACATTGAAGACCGG + Exonic
1122568969 14:102681031-102681053 TGGTAGACAAAATTAAAGATGGG + Intronic
1122818376 14:104326667-104326689 TGGTGCTCATTATTGAAGCTGGG - Intergenic
1125299201 15:38236388-38236410 TTGTTCTCAACATTGAAGAATGG - Intergenic
1125415866 15:39451845-39451867 TGATGGAAAACACTGAAGATTGG - Intergenic
1126981777 15:54252427-54252449 TAGTGCAGAACAATGAAGGTGGG + Intronic
1131679059 15:94702441-94702463 CGGAGCACAGCACTGAAGATGGG - Intergenic
1133434396 16:5766704-5766726 TGGTCCCCAACATTGGAGGTGGG - Intergenic
1140778719 16:78274590-78274612 TGATGAGCAACATTGAACATTGG - Intronic
1150422652 17:65052691-65052713 TGTTACACAGCATTGAAGACAGG - Intronic
1152902546 17:82951755-82951777 TGAGGCACAACATTGAAATTAGG - Intronic
1155395970 18:25387173-25387195 TGGGGCCCTACAGTGAAGATAGG - Intergenic
1159340175 18:67124540-67124562 TGGTACATAACATTGCATATAGG + Intergenic
1160266071 18:77341511-77341533 TGGTGCACAACAGCTGAGATGGG - Intergenic
1160302813 18:77701235-77701257 TGCTGCACAAAAATGATGATGGG - Intergenic
1160958260 19:1705344-1705366 TGATCCCCAACATTGAAGGTGGG - Intergenic
1161658924 19:5533973-5533995 TGGTCCACAAGATAGAAGTTGGG + Intergenic
1164138508 19:22436380-22436402 GGGTGCAAAACTTAGAAGATGGG - Intronic
1167271390 19:48508503-48508525 TGGTACCCAACATTGGACATGGG + Intronic
1167331913 19:48861372-48861394 TGGTGCACAACATGGATGGATGG + Intronic
925676307 2:6365539-6365561 TTGTGCACAACAATGAGAATAGG + Intergenic
927805484 2:26143102-26143124 TGGTGCACAGCCTTTAAGACTGG - Intergenic
931171118 2:59804672-59804694 TGGGGCAGAGCATTGAAGAATGG - Intergenic
931719831 2:65059151-65059173 TGGTGAACAACATTAAAGATAGG - Intronic
932114996 2:69037989-69038011 TGGTGTAAAACATGGAAGTTGGG - Intronic
932725533 2:74176850-74176872 TGGTGCAGCACTTTGAAGTTTGG + Intronic
943967641 2:194357695-194357717 TTATGTACAATATTGAAGATTGG + Intergenic
944754356 2:202744477-202744499 TGATGCACAATATTGAAGGTGGG - Intronic
1171817725 20:29803275-29803297 TGGAGGACAACTTAGAAGATAGG + Intergenic
1173953381 20:47011158-47011180 TGGTGCACAACATTGAAGATGGG + Intronic
1174708653 20:52682698-52682720 TCATGCACAACAATGAATATAGG - Intergenic
1174801158 20:53563987-53564009 TGGTGGAAGACATTGAAAATAGG - Intergenic
1175118945 20:56703567-56703589 TGCTGCACAACACTGAGGAAGGG - Intergenic
1177379302 21:20317600-20317622 TGATTCCCAACATTGGAGATGGG - Intergenic
951393934 3:22141515-22141537 TGGTGCAAATAATTGAGGATTGG - Intronic
952546364 3:34423970-34423992 TGTTGCAAAACAGTGAAGACAGG - Intergenic
953444344 3:42949920-42949942 TGTTGCACTACAGTAAAGATAGG + Intronic
960015921 3:112887711-112887733 TGGTGGAGAACATTGATGGTGGG - Intergenic
961379715 3:126488941-126488963 TGGTGCTCAGCTATGAAGATGGG + Intronic
961689320 3:128657179-128657201 AAGTGCAAAATATTGAAGATGGG - Intronic
962000565 3:131290876-131290898 TGGTGCAGGACATTGATAATGGG - Intronic
967798319 3:193623864-193623886 TGGTGCACAAAATCAAAGACAGG + Intronic
970912067 4:21288638-21288660 TGGTGCCCAACATTACAAATTGG + Intronic
971930599 4:33077725-33077747 TCTTGCACAAAACTGAAGATAGG + Intergenic
973959649 4:56097068-56097090 TGGTGCACAAAGTTGGAGGTTGG + Intergenic
974227606 4:59066918-59066940 TTGTGAACAACATTTAAAATGGG + Intergenic
976151252 4:82094513-82094535 TGGTAAACAAGATTGAAGAATGG - Intergenic
976158804 4:82176229-82176251 GGCTGCACAACATCGAATATTGG - Intergenic
976183769 4:82424836-82424858 TGCAGGACGACATTGAAGATTGG - Exonic
977026754 4:91829015-91829037 TGGTGCACAGAATTGGAGTTTGG + Intergenic
983509983 4:168598585-168598607 AGGTGAACATGATTGAAGATGGG - Intronic
983669653 4:170221487-170221509 TGATCCCCAACATTAAAGATGGG + Intergenic
989813300 5:45704547-45704569 TGGTCAACAAAATTAAAGATTGG - Intergenic
991379764 5:66007764-66007786 TGCTGAATAACTTTGAAGATAGG + Intronic
994690557 5:103014042-103014064 AGGGGCACAACAATGAAGACTGG - Intronic
994700061 5:103122284-103122306 TGCTGCGGAACATAGAAGATGGG + Intronic
995305561 5:110643519-110643541 TGTACCACAAAATTGAAGATGGG + Intronic
996919899 5:128755773-128755795 TGATGCACATCACTGAAAATTGG - Intronic
1004858940 6:19781457-19781479 TGGAGCAAAACATTGATGTTTGG + Intergenic
1005779386 6:29172862-29172884 GGATGCACAACAGTGAAGAGAGG - Intergenic
1005974771 6:30789726-30789748 TGCTGCACAACACAGAAGAGGGG + Intergenic
1012434774 6:99203953-99203975 TGGAGCACTTCATTGCAGATGGG - Intergenic
1012460986 6:99459834-99459856 TGGTGCTCCACATTGCAGACAGG - Intronic
1014044076 6:116863559-116863581 TGGTGCTCAATATTCAATATAGG - Intergenic
1014756099 6:125302976-125302998 TGGTGTACAAGATAAAAGATGGG + Intergenic
1015725908 6:136299417-136299439 TGGTGCATAAAACTGAAAATTGG + Intergenic
1018487208 6:164253382-164253404 TGCTTCACAACACTGAAGAATGG + Intergenic
1024962869 7:54995868-54995890 TGGAGCAAAACCTTGTAGATTGG + Intergenic
1032437428 7:131911631-131911653 TGGTGCACCCCATTTTAGATAGG + Intergenic
1033587966 7:142788207-142788229 AGTTGCACAACATTAAAGACTGG - Intergenic
1037228013 8:16619355-16619377 TGGTGAACAAAACTGAAAATTGG - Intergenic
1037666322 8:20973151-20973173 TGCTGCACACCACTGATGATGGG + Intergenic
1041460732 8:58108775-58108797 TGGTTCACAACATGGAAAAGTGG - Intronic
1049877996 8:145039457-145039479 TAATCCACAGCATTGAAGATGGG + Intergenic
1050607991 9:7321128-7321150 TGGTGCAGAACAATGTGGATTGG + Intergenic
1052541869 9:29821764-29821786 TCATGAACAACATTGAAGATAGG + Intergenic
1058525323 9:105851385-105851407 TGCTGCAAAACAATGAAGACAGG + Intergenic
1190022337 X:46890579-46890601 TTGTGCAAAGCATTAAAGATGGG + Intronic
1202588304 Y:26455602-26455624 TGGTGTAAGACATTGAAAATAGG + Intergenic