ID: 1173956914

View in Genome Browser
Species Human (GRCh38)
Location 20:47040411-47040433
Sequence ACTGAGGCTCAGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 461}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173956914_1173956918 -5 Left 1173956914 20:47040411-47040433 CCTTCCACAGTCTGAGCCTCAGT 0: 1
1: 0
2: 4
3: 71
4: 461
Right 1173956918 20:47040429-47040451 TCAGTTTTCTGGTCTGTCGAAGG 0: 1
1: 0
2: 2
3: 36
4: 387
1173956914_1173956920 -3 Left 1173956914 20:47040411-47040433 CCTTCCACAGTCTGAGCCTCAGT 0: 1
1: 0
2: 4
3: 71
4: 461
Right 1173956920 20:47040431-47040453 AGTTTTCTGGTCTGTCGAAGGGG 0: 1
1: 0
2: 3
3: 31
4: 381
1173956914_1173956919 -4 Left 1173956914 20:47040411-47040433 CCTTCCACAGTCTGAGCCTCAGT 0: 1
1: 0
2: 4
3: 71
4: 461
Right 1173956919 20:47040430-47040452 CAGTTTTCTGGTCTGTCGAAGGG 0: 1
1: 2
2: 12
3: 208
4: 1910

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173956914 Original CRISPR ACTGAGGCTCAGACTGTGGA AGG (reversed) Intronic
900529043 1:3143851-3143873 GCTGAGGCCCTGTCTGTGGATGG + Intronic
900690612 1:3978201-3978223 AAGGAGGCTTTGACTGTGGAGGG + Intergenic
901218878 1:7570900-7570922 ACTGAGGCTCAGAGTGGTTAAGG - Intronic
902246460 1:15124222-15124244 ACCGAGGCTCAGACAGGGTAAGG - Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902542435 1:17164619-17164641 ACTGAGGCTGAGAGGGTTGAAGG - Intergenic
902572470 1:17355604-17355626 ACTGAGGCTCAAACAGGTGAAGG + Intronic
902665073 1:17931656-17931678 ACCGAGGCTCAGAGTGATGAAGG - Intergenic
902778173 1:18687821-18687843 ACCGAAGCCCAGACTGGGGAAGG - Intronic
902892919 1:19457676-19457698 CCTGATGCTCACACTGCGGACGG + Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
903014731 1:20354461-20354483 ACTGAGGCCCAGACGGGGGCAGG - Intronic
903304696 1:22404633-22404655 ACTGAGGCTCAGACAGGCGAGGG - Intergenic
903342036 1:22660712-22660734 ACTGAGGCTCAGAGAGAGGCAGG + Intronic
903465686 1:23551220-23551242 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
903473316 1:23602521-23602543 ACTGAGGCTCAGAGAGGGAAAGG - Intronic
903543650 1:24110522-24110544 TCTGGGGCTCGGGCTGTGGAGGG + Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903891420 1:26572859-26572881 ACTGAGGCTCAGAGAGTTGAAGG + Intronic
904111052 1:28126416-28126438 ACTGAGGCTCAGAGTGGTCAAGG + Intergenic
904338105 1:29810905-29810927 ACTGAGGCCCAGATTGGGGCAGG + Intergenic
904361592 1:29976729-29976751 ACTGAGGTTCAGAGAGGGGAAGG - Intergenic
904461704 1:30684608-30684630 ACTGAGGCCCAGATTGAGGCAGG - Intergenic
904538246 1:31215481-31215503 ACTGAGGCTCAGACAGGTGTAGG + Intronic
904623085 1:31787287-31787309 ACTGAGGCTCAGAAAGGGCAAGG + Intergenic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
904921442 1:34011252-34011274 ACTGGGGCTCAGCCTCTGGTGGG - Intronic
904932946 1:34104870-34104892 ACTGAGGCACATGCTGTGCAGGG - Intronic
905213283 1:36389178-36389200 ACTGAGGCTCAGAGAGGGAAAGG - Intergenic
905473475 1:38209726-38209748 ACTGAGGCTCAGAGAGGAGATGG + Intergenic
906077997 1:43066352-43066374 ACTGAGGCTTAGAAAGGGGAAGG - Intergenic
906127800 1:43438210-43438232 ACTGAGGCACAGCTTGGGGAAGG + Intronic
906646301 1:47477988-47478010 ACTGAGGGTCAGAAAGGGGAAGG - Intergenic
907041905 1:51268720-51268742 ACTGAGGCTAAGATTCAGGAAGG + Intronic
907266821 1:53266932-53266954 ACTTGGGGTCACACTGTGGAAGG - Intronic
907272245 1:53297970-53297992 ACTGAGGCCCAGAATGGGAAGGG - Intronic
907276733 1:53320956-53320978 ACTGAGGCTCAGAAAGGAGACGG - Intronic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
907966283 1:59333039-59333061 ACTGAGGCTCAGAAAGTTGATGG + Intronic
908125495 1:61026199-61026221 ACTGTGGCTCACACTTTGGGAGG - Intronic
908325680 1:63021204-63021226 ACAGAGGCTCAGACAGTTAAAGG + Intergenic
909074873 1:71040773-71040795 AGTGTGACTCAGACTGTGAAAGG + Intronic
909183624 1:72456573-72456595 ACAGAGGCTGAGACTGCTGAGGG + Intergenic
909773379 1:79454695-79454717 ACTGAGGCTGGGTTTGTGGATGG + Intergenic
909938762 1:81586359-81586381 GCTGAGGCTGAGAATGTGGCTGG + Intronic
910400524 1:86833702-86833724 AATGAGGCTCTGACTGCGCAGGG - Intergenic
910702383 1:90090160-90090182 CCTGAGGCTGAAAATGTGGATGG + Intergenic
912255633 1:108055303-108055325 GCTGAGGTTAAGCCTGTGGATGG - Intergenic
912540883 1:110414367-110414389 TCTGAGGCTCAGAGAGGGGAAGG + Intergenic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
915563451 1:156700887-156700909 TTTGAGGAGCAGACTGTGGATGG - Exonic
916559843 1:165925197-165925219 ACTGAGACTGAGAGGGTGGATGG - Intergenic
919834702 1:201565760-201565782 ACTGAGGCCCACACAGTTGAAGG + Intergenic
920073233 1:203318358-203318380 ACTGAGGCTCAGAGTGGAGAAGG - Intergenic
920122427 1:203668739-203668761 ACAGTGGCTCACACAGTGGAAGG - Intronic
920185053 1:204154300-204154322 ACTGAGGCCCAGAGAATGGAAGG - Intergenic
920390260 1:205595648-205595670 ATTGAGGCTCAGAGAGGGGAAGG - Intronic
920746938 1:208637857-208637879 ACTAAGCCTCATACAGTGGAGGG - Intergenic
920770395 1:208879418-208879440 AATGAGGAACAGATTGTGGAAGG - Intergenic
921081094 1:211738850-211738872 TCTGAGGCTGAGGCTGTGGCAGG + Intergenic
921330921 1:214034801-214034823 ACTGAGGCTCAGAGAGGGTAAGG - Intronic
921364691 1:214362591-214362613 ACTGAGGCTCAGCCTTTGATGGG + Intronic
921791409 1:219294722-219294744 CCTGAGGCACAGACTCTGGATGG + Intergenic
922026418 1:221753832-221753854 ACTGAGGCTCAGAAAGAGTAAGG - Intergenic
922210087 1:223479732-223479754 TCTGAGGCTGGGAGTGTGGAGGG - Intergenic
923566378 1:235079658-235079680 ACTCAGGCCCAGACTGGGGCAGG - Intergenic
924921237 1:248631406-248631428 ACTGAGGCTCAGAGTCAGGTGGG + Intergenic
1062834717 10:628120-628142 ACTGAGGCACAGAACGTGGCAGG + Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1065231122 10:23599347-23599369 AATGTGGTTCAGATTGTGGATGG + Intergenic
1069054295 10:63828867-63828889 ACTGAGGCTGAGAATGTTTAAGG - Intergenic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069744146 10:70704183-70704205 GCTGTGGCTGAGGCTGTGGAGGG + Intronic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1070802167 10:79250233-79250255 ACTGAGGCTCAGACAGAAGGGGG - Intronic
1070916768 10:80160083-80160105 GCTGAGACTCAGGCTGGGGAAGG - Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1072481723 10:95815557-95815579 ACTGAGGCTCATACAGTGTCTGG - Intronic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073237458 10:102030214-102030236 ACTGAGACTCAGACTGGGCTGGG - Intronic
1073626984 10:105108495-105108517 CCTGAGGCTCAGTCTTTGGATGG - Intronic
1074249172 10:111726712-111726734 ACTGAGGCTCAGAGTGAAGAAGG - Intergenic
1074688321 10:115980060-115980082 ACTGAGGCCCAGATTAGGGAAGG - Intergenic
1074869992 10:117568803-117568825 ACTGAGGCCAAGAAAGTGGAGGG + Intergenic
1075817219 10:125273863-125273885 ACTGAGTGTAATACTGTGGAAGG + Intergenic
1076652438 10:131999171-131999193 ACTGAGGCTCAGATAGTCCATGG + Intergenic
1076921813 10:133458280-133458302 CCTGAGCCTCAGACTGCGGAAGG - Intergenic
1077317582 11:1926220-1926242 ACTGAGGCTCAGAGGATGGCCGG - Intronic
1077431946 11:2520152-2520174 ACTGAGGCTCAGACACAGCATGG - Intronic
1078406635 11:11075617-11075639 TCAGAGGCACACACTGTGGATGG - Intergenic
1080459169 11:32438494-32438516 ACTGAGGCCCAGACAGCCGAAGG + Intergenic
1081522068 11:43891721-43891743 AGTGGGGCTCAGACTAGGGACGG - Intronic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1081703237 11:45164906-45164928 ACTGAGGCTCAGAGAGGGAAAGG + Intronic
1082871237 11:57945127-57945149 AACGGGGCTAAGACTGTGGATGG - Intergenic
1082952162 11:58829007-58829029 ACTGAGGCTCAGAGAGTTGAAGG + Intergenic
1083307214 11:61767422-61767444 ACTGAGGCTCAGAGAGGGAAAGG + Intronic
1083544645 11:63539092-63539114 ACTGAGGGTCAGTCTGCAGAGGG + Intronic
1083623307 11:64059485-64059507 ACCCAGGGTCAGCCTGTGGAAGG - Intronic
1083707894 11:64529299-64529321 ACAGAGGCTGAAATTGTGGATGG + Intergenic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1084264810 11:67999406-67999428 ACTGAGGCCCAGAGGGCGGAAGG + Intronic
1084532002 11:69732844-69732866 ACTGAGGCTCAGAGAGGTGAGGG + Intergenic
1085022756 11:73219410-73219432 ACTGAGGCTCAGAGAAAGGACGG - Intronic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085392453 11:76189394-76189416 AGGGTGGCTCAGACTGTGGGTGG + Intronic
1085463578 11:76709652-76709674 AGTGAGGCTCAGAGAGTGGAAGG - Intergenic
1085705875 11:78786524-78786546 ACTGAGGCTCAGAAAGTTGACGG + Intronic
1085732203 11:79009688-79009710 ACTGAGGCTCAGAGAGGGCAGGG + Intronic
1087271262 11:96114422-96114444 ACTGAGGTTCTGAGTGGGGAGGG - Intronic
1087837846 11:102892503-102892525 ACTGTGCCTCAGACAGTGGCTGG - Intergenic
1088702177 11:112423127-112423149 TCTGAGGCTCAGACTTTTGAGGG + Intergenic
1088741375 11:112770119-112770141 CATGAGGGTCAGACTGAGGACGG + Intergenic
1089329151 11:117677783-117677805 ACTGAGGCACAGACAGGTGAAGG + Intronic
1089364985 11:117915955-117915977 ACTGAGGCTCAGAATGTTAATGG + Intronic
1090178725 11:124674384-124674406 AATGAGGCTCAGACTATGGAGGG - Exonic
1090490267 11:127154574-127154596 ATTCAGGGGCAGACTGTGGAAGG - Intergenic
1091309550 11:134562860-134562882 ACTGAGCCCCAGGCTGTGGGTGG + Intergenic
1091829995 12:3542692-3542714 ACGGAGGCTCCGAGTGGGGAGGG - Intronic
1091853814 12:3722930-3722952 ACTGAGGCTCAGAGAGGGTAAGG - Intronic
1092134647 12:6138199-6138221 GCTGAGGCTCAGACAGGGTAAGG + Intergenic
1092655645 12:10682072-10682094 ACTGTGGCAGAGACTGTGGTAGG + Intergenic
1092950654 12:13500039-13500061 ATGGAAGCTCAGTCTGTGGAAGG + Intergenic
1093768174 12:22988816-22988838 ATTGAGTCACAGACTGTAGAGGG - Intergenic
1093967801 12:25345540-25345562 ACTGGCACTCAGACTGTGAAGGG + Intergenic
1094588070 12:31796001-31796023 ATTGAGGCTCAGGCTGGAGACGG - Intergenic
1095977157 12:47947540-47947562 GCTGGGGCTCAGGCTGTGGGAGG + Intergenic
1096064737 12:48730645-48730667 ACTGAGGCTCAGGCCGGGCATGG + Intergenic
1097392090 12:59027247-59027269 ACTGAGGTTCAGAGTGGTGAAGG + Intergenic
1097711680 12:62924199-62924221 ACTGAGGCCCAGAGTGGGGGGGG + Intronic
1099038060 12:77614685-77614707 ACTGAGGCACTCACTGTGGAAGG - Intergenic
1099360290 12:81692271-81692293 GCTCAGGCTCAAACTGTGGGAGG - Intronic
1100032616 12:90211064-90211086 ACTCAGGCTCAGAATTTGAAGGG - Intergenic
1101009804 12:100437747-100437769 AATGAGGCTCAAAGAGTGGAAGG + Intergenic
1101768916 12:107730357-107730379 GCTGAGGCTCAGGCTGGGCATGG - Intergenic
1101895924 12:108756622-108756644 ACTGAGGCTCAGAGTGGTGAAGG + Intergenic
1101990270 12:109478117-109478139 ACTGAGGCTCAGAGAGGTGAGGG - Intronic
1102024069 12:109703547-109703569 ACTGAGGCTCAGAGGGTTGATGG + Intergenic
1102414009 12:112744694-112744716 ACTGAGGCTCAGAGAGTCAAGGG + Intronic
1102476247 12:113190772-113190794 ACAGGGGCTCAAACTGTGGCTGG + Intronic
1102748948 12:115275311-115275333 ACTGAGGCTCAGAGTGGTTAAGG - Intergenic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1103434242 12:120912532-120912554 GCTGAGGCTGAGGCTGAGGAAGG - Intergenic
1103721066 12:122975741-122975763 ACTGAGGCTTAGAGAGTGAAGGG + Intronic
1105388296 13:19952819-19952841 ACTGAGGCTCAAAAAGTGGAGGG + Intergenic
1105508787 13:21034214-21034236 CCTGAGGCTCAGAAGGTGCATGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106422962 13:29598742-29598764 ACTGAGGCACAGAGTGAGCAGGG - Intergenic
1107784164 13:43937671-43937693 ACTGAGGCTCAGAGAGGGGAGGG + Intergenic
1109420875 13:62110023-62110045 ACTGAGCCTCTGGCTGTGGCAGG + Intergenic
1109502904 13:63260681-63260703 ACTCAGGCCCAGACACTGGAAGG + Intergenic
1114501202 14:23170158-23170180 ACTGAGGCTCAGAGAGGTGAAGG + Intronic
1114519335 14:23323073-23323095 ACTGGGGCTCTGACTGGGGTTGG + Intronic
1115434769 14:33360148-33360170 ACTGAGTCTCAGGCTGAGGCAGG - Intronic
1115466070 14:33715648-33715670 ACTGAGGCCCAGACTTGTGATGG - Intronic
1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG + Intergenic
1117721674 14:58634785-58634807 AATGATGCTCAGACTTTGGTGGG + Intronic
1119176026 14:72568204-72568226 ACTAAGGCTCAGAATGAGGGTGG - Intergenic
1119239599 14:73048184-73048206 AATGAGGCCCACACTGTAGATGG + Intergenic
1119443585 14:74646053-74646075 ACCGAAGCTCACACTGCGGAGGG + Intergenic
1119620771 14:76130436-76130458 ACTGAGCCTCACACTGTGCTGGG - Intergenic
1121055271 14:90846737-90846759 AATGAGGCTTGGTCTGTGGAAGG - Intergenic
1121310353 14:92932375-92932397 TCGGAGGCTCTGGCTGTGGATGG + Exonic
1121442650 14:93958508-93958530 ACTGAGGCACAGAGCGGGGATGG - Intronic
1121739081 14:96238837-96238859 ACTGTGGCCCAGAGGGTGGAGGG - Intronic
1121817695 14:96941027-96941049 ACTGAGGCTCACAGAGAGGAAGG + Intergenic
1121844404 14:97160260-97160282 ACTGAGGCTCAGAAAGGTGAAGG - Intergenic
1122470488 14:101962784-101962806 TCTGAGTCTCAGATGGTGGATGG + Intergenic
1122621174 14:103058180-103058202 ACTGAGGCCCAGACGGTGTGGGG + Intergenic
1122652477 14:103232976-103232998 ACTGAGGCGCGGAGTGTGGCAGG + Intergenic
1122693528 14:103542354-103542376 ACTGAGGCTCAGAGAGGGCAAGG - Intergenic
1122804563 14:104250010-104250032 ACTGAGGCTCAGAGGTGGGATGG + Intergenic
1123049158 14:105532310-105532332 GCTGTGGCTCCGACTGTGGCAGG + Intergenic
1123507467 15:20958714-20958736 ACAGAGCCTCAGACTCTGGAAGG + Intergenic
1123564693 15:21532455-21532477 ACAGAGCCTCAGACTCTGGAAGG + Intergenic
1123600949 15:21969746-21969768 ACAGAGCCTCAGACTCTGGAAGG + Intergenic
1124023760 15:25946099-25946121 ACTGAGGCTGAGAGTGGGGAAGG + Intergenic
1124702324 15:31926850-31926872 AATGAGGCACAGACTGTGCATGG - Intergenic
1125673034 15:41487036-41487058 AGAGTGACTCAGACTGTGGAGGG + Intergenic
1126143773 15:45457684-45457706 ATTCAGGCACAGCCTGTGGAAGG + Intergenic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128232608 15:66046142-66046164 ACTGAGGCTCAGAAAGGTGAAGG + Intronic
1128413163 15:67419184-67419206 ACTGAAGCTCAGAGATTGGAGGG + Intronic
1128531116 15:68448691-68448713 GCTGAGGCTCAGATAGGGGAAGG - Intergenic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1130556792 15:84928427-84928449 ACTGAGGAACTGACTGGGGAAGG - Intronic
1130757820 15:86784654-86784676 ACTGTGGCTCAGAGAGTGGTGGG - Intronic
1202973057 15_KI270727v1_random:259566-259588 ACAGAGCCTCAGACTCTGGAAGG + Intergenic
1132591233 16:727247-727269 ACTGGGGCTCGGACTGGGGGCGG + Intronic
1132724111 16:1331465-1331487 ACTGAGGCCCGGGCAGTGGAGGG + Intergenic
1134479740 16:14607918-14607940 ACTTAGGGTGAGACTATGGATGG - Intronic
1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG + Intronic
1136063557 16:27743483-27743505 ACTGAGGCTCAGTCAGTGTCAGG + Intronic
1136230211 16:28881228-28881250 ACTGAGGCTCAGAGGGATGAAGG - Intronic
1137405252 16:48184121-48184143 ACTGAGGCCCAGACAAGGGAAGG - Intronic
1137568965 16:49552282-49552304 ACTGAGGCTCAGAAAGGGGCAGG - Intronic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1138288197 16:55825735-55825757 ACTGAGGCCCAGACAGGGAAGGG - Intronic
1138368043 16:56499353-56499375 ACTGAGGCTCACACTGGTGAGGG + Intronic
1138969739 16:62130336-62130358 GCTGAGAATCAGAGTGTGGACGG + Intergenic
1139060515 16:63245158-63245180 ACTGGGGCTCTGTCTATGGATGG + Intergenic
1139275725 16:65725854-65725876 ACTGAGGAATACACTGTGGAAGG + Intergenic
1139307277 16:65997813-65997835 ACTTAGGCTCAGAATGCTGATGG - Intergenic
1141259977 16:82443865-82443887 ACTGAGCCTCAGAGAGGGGACGG - Intergenic
1141429072 16:83961645-83961667 ACTGAGGCTCAGATAGGGAAAGG + Intronic
1141868783 16:86770030-86770052 ACTGAGGCTGAGAGTGGGGCAGG + Intergenic
1141922146 16:87143492-87143514 ACTGAGGCTTGGAGTGGGGAAGG - Intronic
1142126969 16:88415088-88415110 ACCGAGGCTCAGAGAGGGGAAGG - Intergenic
1142325931 16:89414631-89414653 ACTGAGGCTCGGAGAGTGGAAGG + Intronic
1142473414 17:176077-176099 AATGAGGCTCAGAGAGGGGAGGG + Intronic
1142493281 17:292570-292592 ACCGAGGCTCAGACTGAACAGGG - Intronic
1142608731 17:1096533-1096555 TCTGAGGCTGTGGCTGTGGAGGG + Intronic
1143015032 17:3887176-3887198 ACTGGGGCTCAGAGTCGGGAAGG - Intronic
1143217641 17:5236998-5237020 ACTGAGGCTCAGAGAAGGGAAGG - Intergenic
1143300739 17:5908976-5908998 TCTGGGGCTCAGAGTGTGAAAGG - Intronic
1143807580 17:9441981-9442003 TCTGAGAGTCAGCCTGTGGATGG - Intronic
1143852202 17:9821546-9821568 ACTGAGGCTCAGAGAGGTGAAGG + Intronic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1146017940 17:29248718-29248740 ACTGAGGCTCAGGCTGGGCGCGG + Intronic
1146595461 17:34164612-34164634 ACTGAGGTTCAGAGAGTGAAAGG + Intronic
1146649199 17:34596340-34596362 ACTGAGGCTTAGAGTATGGAAGG + Intronic
1147031335 17:37639715-37639737 ACTGAGTCTCACTCTGTGGCTGG - Intronic
1147588146 17:41664895-41664917 ACTGAGGCTCAGAGAAGGGAAGG - Intergenic
1147689558 17:42307064-42307086 ACTGAGGCACAGAGAATGGATGG - Intronic
1148093941 17:45039664-45039686 ACTGAGGCTCAGAGGAGGGAAGG - Intronic
1148454086 17:47801597-47801619 ACTGAGGCTCAGGAGGTGAAAGG + Intergenic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1149576205 17:57715402-57715424 ACTGAGGCTCAGAGAATGGAAGG + Intergenic
1150638216 17:66931409-66931431 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1151516513 17:74599558-74599580 AGTAAGGCTCAGAGCGTGGACGG - Intergenic
1152077596 17:78168878-78168900 ACAGCGGGACAGACTGTGGAGGG - Intronic
1152763446 17:82121950-82121972 ACCGAGGCTGAGAGTGTGGGTGG - Intronic
1154205612 18:12334333-12334355 ACAGACACTGAGACTGTGGATGG + Intronic
1155426649 18:25714310-25714332 ACTGAAGCTCAGAGTGGGAAAGG - Intergenic
1156576645 18:38324634-38324656 ACTGATCCTAAGACTGTGGTTGG + Intergenic
1156822393 18:41388757-41388779 ACTGAGGCTCAGAAGGTTAAAGG - Intergenic
1157393073 18:47319093-47319115 ACTGAGGCACCCACTGTTGATGG - Intergenic
1158462131 18:57655711-57655733 CCTGGGGCTCACCCTGTGGATGG - Intronic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1160677498 19:399284-399306 ACTGAGGCTCAGAGAGGGGGAGG + Intergenic
1161113034 19:2480188-2480210 ACTGAGGCACAGACAGGTGAAGG - Intergenic
1161262372 19:3345121-3345143 ACTGAGGCTCAGAGAGGGAAAGG - Intergenic
1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG + Intronic
1162397603 19:10426224-10426246 ACTGAGGCTCTGACAGGTGAAGG - Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1163258376 19:16171728-16171750 ACTGAGGCTCAGACAGGGCGGGG - Intronic
1163262577 19:16199997-16200019 AGTGAGGCTCAGACAGGAGAAGG - Intronic
1163366600 19:16879102-16879124 CCTGAGGCCCACACTTTGGAGGG + Exonic
1163730856 19:18948525-18948547 ACTGAGGCTCAGAGAATGGTAGG - Intergenic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1166086532 19:40479352-40479374 AGTGAGCCACAAACTGTGGAGGG - Intronic
1166091193 19:40510165-40510187 ACTGAGCCTCAGAGAGGGGAAGG - Intronic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166678117 19:44751515-44751537 ACTGAGGCTCAGAGCAGGGAAGG - Intronic
1166725167 19:45022436-45022458 ACTGAGGCTCAGAGAGGGTAAGG + Intronic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1166843954 19:45714975-45714997 ACAGAGGCTCAGAGTGGGGAAGG + Intronic
1166856447 19:45784678-45784700 ACCGAGGCCCAGACAGGGGAAGG - Exonic
1166873274 19:45883397-45883419 ACTGAGGCTCAGAGAGGGGATGG - Intergenic
1167163012 19:47779865-47779887 ACTGAGGCTGGGACTGGGGTGGG + Intronic
1167259703 19:48451386-48451408 ACTGAGGCTCAGCAAGAGGAAGG + Intronic
1167654556 19:50755101-50755123 ACTGAGGCTCAGGGTGGGGATGG + Intergenic
1168115481 19:54219743-54219765 ACTGAGGCCCAGGCAGGGGAGGG + Intronic
1168121284 19:54253892-54253914 ACTGAGGCCCAGGCAGGGGAAGG + Intronic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
1168322873 19:55520825-55520847 ACTGAGGCTCAGAGAAGGGAGGG - Intergenic
1168459457 19:56541191-56541213 ACTAAGACTCAAACTGTGGGAGG - Intronic
926704498 2:15827107-15827129 ACTGAGGCTCAAAGCATGGATGG - Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
926878890 2:17518563-17518585 GCTGAGGCTGGGGCTGTGGAGGG - Intergenic
927879628 2:26681459-26681481 ACAGAGGCCCAGAGTGGGGAAGG - Intergenic
927922013 2:26979937-26979959 GCTGAGGGTCAGGTTGTGGATGG + Intronic
928741386 2:34357712-34357734 ACTGAGGCTCAGACAATTCACGG - Intergenic
931627144 2:64267070-64267092 TCTGAGGCTCACTCTGTAGAGGG + Intergenic
931696744 2:64876583-64876605 ACTGAGGATTAGTCTGTGCAGGG + Intergenic
932436079 2:71703239-71703261 TGTGAGGCTCAGAGTGTGCAGGG + Intergenic
933855820 2:86413174-86413196 ACTGAGGCTGAGACTCTAGGAGG - Intergenic
934563989 2:95328359-95328381 ACTGTGGCTCAGACAGTGTGTGG - Intronic
934567542 2:95348863-95348885 ACTGAGGCTTCGACTGTTTAAGG - Intronic
936457499 2:112686575-112686597 ACTGTGCTTCAGGCTGTGGAAGG - Intergenic
937065034 2:119011453-119011475 ACTGAGGAACAGCCTGGGGAAGG + Intergenic
937453304 2:122020239-122020261 ACTGAGGCTCAGAGGGGTGACGG + Intergenic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
942337218 2:174901502-174901524 ACTGAGGCAAATGCTGTGGAAGG - Intronic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946405944 2:219492154-219492176 ACGGAGGCTCGGATTGTGGGGGG + Exonic
947031520 2:225801231-225801253 ACTGAAGCTCAGATATTGGAAGG - Intergenic
947754429 2:232551133-232551155 ACTGAGGCTCAGAGGGGAGAGGG - Intronic
948892328 2:240913574-240913596 ACTGAGGCAGGGATTGTGGATGG - Intergenic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1168860478 20:1042954-1042976 ACTGAGGCTCAGAGAGGTGAAGG + Intergenic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1170557891 20:17530337-17530359 ACTGAGGCTCAGAAAATGTAGGG - Intronic
1172121417 20:32601129-32601151 ACTGAGGCTCAGGGTGGGGAAGG + Intronic
1172167322 20:32907220-32907242 ACTGAGGCTCAGAAAAGGGAAGG - Intronic
1172197408 20:33101401-33101423 ACTGAGGCTCAGAGTGAAGTTGG - Intronic
1172484036 20:35287853-35287875 GCTGAGTCGCAGCCTGTGGAGGG - Exonic
1173066227 20:39715104-39715126 CCTGAGGCTCTCACTGTGGAAGG - Intergenic
1173147360 20:40536113-40536135 CCTGTGTCTCAGACTGTGCAGGG - Intergenic
1173193788 20:40896983-40897005 ACTGAGGCCCAGAAGATGGAAGG - Intergenic
1173292294 20:41725602-41725624 TCTGATTCTCAGACTATGGATGG + Intergenic
1173324407 20:42019442-42019464 ACTGAGTCTCAGAGAGGGGAAGG - Intergenic
1173647894 20:44644946-44644968 ACTGAGGCTCAGAGAGTGGGAGG + Intronic
1173648238 20:44646926-44646948 ACTGAGACTCAGAGAGGGGAGGG - Intronic
1173893471 20:46531504-46531526 ACTGAGGCTCAGAGAGGAGAGGG + Intergenic
1173941595 20:46915468-46915490 ACTGAGGCTCAGACAGGCCAAGG + Intronic
1173956914 20:47040411-47040433 ACTGAGGCTCAGACTGTGGAAGG - Intronic
1175276578 20:57774790-57774812 ACTGAGGCTCAGTGGGTAGAGGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175914210 20:62418291-62418313 ACTGAGGCTCAGTGTGGGGGCGG - Intronic
1176285633 21:5017845-5017867 ACTGAGACTCAGACTGCAGAGGG - Intergenic
1178882333 21:36459566-36459588 CCTGAGGCTCTGAATGTGGGAGG - Intergenic
1179793206 21:43767660-43767682 ACTGAGGCACAGACTGTGCATGG - Intergenic
1179871548 21:44245630-44245652 ACTGAGACTCAGACTGCAGAGGG + Intergenic
1180201078 21:46224659-46224681 ACTGAGGCTCAGCCAGTAAATGG + Intronic
1181631485 22:24153917-24153939 ACTGAGGCTCAGAATGGGCTGGG - Intronic
1181939641 22:26465191-26465213 ACTGAGGCTCAGGCAGGGAATGG + Intronic
1182261455 22:29074797-29074819 ACTGAGGCTCAGAGAGCTGAAGG - Intronic
1182281155 22:29218443-29218465 ACTGAGGCTCAGAGAGGTGATGG + Intronic
1182302826 22:29347425-29347447 ACTGAGGCTCAGAGAGTTAAAGG + Intronic
1182428595 22:30287605-30287627 ACTGAGGCTCAGAGAGGGGCAGG - Intronic
1182541412 22:31044685-31044707 ACTGAGGCTCAGAGAGGTGAAGG - Intergenic
1182680472 22:32075454-32075476 ACTGAGGTCCAGACAGGGGAAGG + Intronic
1182785590 22:32905020-32905042 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1183090642 22:35519673-35519695 ACTGAGGCCCAGCCAGGGGAAGG + Intergenic
1183947191 22:41333105-41333127 ACTGAGGCACAGAGTGGGGAGGG + Intronic
1184242094 22:43216737-43216759 ACTCTGGCTCAGACAGTGGAGGG - Intronic
1184368702 22:44068977-44068999 ACAGAGGGTCAGGCTGTGGAAGG - Intronic
1184458780 22:44625708-44625730 ACTGAGGCTCAGGGAGGGGAAGG - Intergenic
1184504828 22:44894394-44894416 ACTGAGGTTCGGAGTGGGGAAGG + Intronic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
1184558351 22:45246225-45246247 ACTGAGGCTTAGACAGGAGAGGG - Intergenic
949863895 3:8531523-8531545 ACTGAGGCTCAGTATGTCCAAGG + Intronic
950276457 3:11665509-11665531 ACTCAGCCTCAGGCTGTGGCTGG - Intronic
950451925 3:13070267-13070289 ACTGAGGCTCAGAGAGGGGAAGG - Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952595496 3:35012795-35012817 ACTGAGGGTCAGACAGTATAGGG + Intergenic
953024452 3:39136840-39136862 ACTGAGGCCCAGACAGGGCAGGG - Intronic
954319995 3:49825825-49825847 ACAGTGGCTCACACTGTGGGAGG - Intergenic
954879296 3:53822977-53822999 ACTGAGGCACAGAGTGGTGAAGG - Intronic
954942309 3:54385334-54385356 GCTGAGGCTCAGACAGGGGAAGG + Intronic
955340106 3:58118506-58118528 ACTGTGGCTCAGACTGGTAAAGG - Intronic
956136728 3:66106896-66106918 ACAGCGGCCCAGACAGTGGAGGG + Intergenic
959811094 3:110620397-110620419 TCTGAGGCTGATGCTGTGGAGGG - Intergenic
961306230 3:125960227-125960249 ATTGAGGCTCAGCCTGAGGCGGG + Intergenic
961386643 3:126526664-126526686 GCTGAGGCTGTGGCTGTGGAGGG - Intronic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
961820290 3:129572453-129572475 ACTGAGGCTCAGAGAGGAGAAGG + Intronic
961911160 3:130317952-130317974 TCTGAGGCTCAGAATGGGGATGG - Intergenic
962839589 3:139221770-139221792 ACTGAGGCACAGATAGGGGAGGG + Intronic
964993144 3:162840561-162840583 ACTGGGGCTCAGAGGGTGGAGGG - Intergenic
966785620 3:183620147-183620169 ACTGAGGCCCAGTGAGTGGAAGG - Intergenic
968915413 4:3495103-3495125 ACTGAGGCTCAGAGAGGGGCGGG - Intronic
969429920 4:7148124-7148146 ACTGAGGCTCAGAAGGTTTAAGG + Intergenic
969478065 4:7432460-7432482 ACTGAGGCTCAGACAGCTGGAGG + Exonic
969688357 4:8689499-8689521 ACTGAGGCTCACAGTGTTTAAGG - Intergenic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
970661242 4:18288091-18288113 ACTGGGGAGCAGCCTGTGGATGG + Intergenic
971274228 4:25180540-25180562 ACTGAGGCTCAGAGAGGGAAGGG + Intronic
971449280 4:26785056-26785078 ACTGAGGCTCAGAGTGGTGCAGG + Intergenic
972202410 4:36730172-36730194 AATGAGGCTGAGATAGTGGAGGG + Intergenic
973098927 4:46237596-46237618 ATTGAGACTTAGACTGTGGGTGG - Intergenic
975265107 4:72354273-72354295 ACTGAAGCTTAGACTGGAGAGGG - Intronic
975382986 4:73724145-73724167 AGTGAGGCTCAGACTGGAGCAGG - Intergenic
975931394 4:79527922-79527944 TCTGAGATTTAGACTGTGGAAGG - Intergenic
976474500 4:85468310-85468332 ACTGGGGCTCAGGCTGGGGAGGG - Intergenic
977320947 4:95515339-95515361 ACTGAGGCTCAGAATGTTAAGGG + Intronic
977695388 4:99959184-99959206 CCTGAGGCTGAATCTGTGGAGGG - Intergenic
978653516 4:111038308-111038330 ACTGCTGCTCAGCCTTTGGATGG + Intergenic
979774106 4:124566115-124566137 ATTGAAGGTCAGATTGTGGAAGG - Intergenic
982101862 4:151975884-151975906 ACTGAGGCTCAGAGAGGGTAAGG + Intergenic
985305982 4:188540700-188540722 ACTGAGGCTCAGCCTCAAGAGGG - Intergenic
985541465 5:489404-489426 GCTGAGGCTCGGGCTGAGGAGGG + Intronic
985812860 5:2103101-2103123 ACGGAGGCTGTGACGGTGGAGGG + Intergenic
986474289 5:8110898-8110920 AATCAGCCTCAAACTGTGGAAGG + Intergenic
986716863 5:10531140-10531162 CCTGAGGATCAGGCTGTGGGGGG - Intergenic
987241330 5:16003279-16003301 ACGGGGGCTCAGAATGAGGAAGG - Intergenic
988539864 5:32099168-32099190 TCTGAGGCTCTGAATATGGACGG - Intronic
990418472 5:55608897-55608919 ACCTGGGCTCAGACTGTGGCAGG + Intergenic
991189570 5:63853733-63853755 ACTGAGGATAAAACTGTGTAGGG + Intergenic
993500269 5:88659807-88659829 ACTGAAGCTCAGCCCGCGGACGG + Intergenic
995657394 5:114442483-114442505 ACTGAGGTTCAGCCTGGTGAAGG - Intronic
996037530 5:118774919-118774941 ACTGAAGCTCAGAAAGTGCAAGG - Intergenic
996282298 5:121745349-121745371 ACTGAGGCCCAGAATGTTGCTGG + Intergenic
997366246 5:133327032-133327054 ACTGAGGCCCAGGGTGGGGAAGG + Intronic
997649740 5:135507486-135507508 ACTGAGGCTCAGAAAGTTCATGG - Intergenic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998231060 5:140361677-140361699 ACTGTGGCTCAGAGTGGAGAAGG + Intronic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998391070 5:141787285-141787307 TTTGAGGCCCAGACAGTGGAAGG - Intergenic
998818221 5:146034626-146034648 ACTGAGGCTGAGACCTTGGTTGG - Intronic
999202781 5:149828053-149828075 ACTGTGGCCCAGAGTGGGGAGGG + Intronic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999259557 5:150229493-150229515 ACTGAGGCTCAGAGAGATGAAGG + Intronic
999284464 5:150386002-150386024 ACTGAGGATCAGAAAGTTGAGGG + Intronic
999304135 5:150508908-150508930 ACTGAGGCTCAGAGAAGGGAAGG + Intronic
999331484 5:150676596-150676618 ACTGAGGCTCAGAGAGCGGCAGG + Intronic
999363677 5:151007120-151007142 ACTGAAGCTCAGAGAGTGAAGGG - Intergenic
999465479 5:151799891-151799913 ATTCAGGCTTAGACTCTGGACGG - Exonic
999583771 5:153068012-153068034 ACTGAGGCTTAGAAAGTTGAGGG + Intergenic
999640613 5:153668863-153668885 AATGAACCTCAGACTGTGGCTGG - Intronic
999869595 5:155735482-155735504 ACTGAGGCTCAGAGGGGGAAAGG + Intergenic
1000175045 5:158743878-158743900 ACAGAAGCTCAGACTGGGCACGG + Intronic
1001096096 5:168776501-168776523 ACTGAGGCTGAGAGTTTGGCAGG + Intronic
1001182422 5:169533018-169533040 ACTGAGGCTCAGAGTGGCTAAGG - Intergenic
1001289817 5:170448916-170448938 ACTGAGGCTCAGGGAGTGTAAGG + Intronic
1001302104 5:170541123-170541145 ACCAAGGCTCAGAGAGTGGAAGG - Intronic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1001422942 5:171600824-171600846 ACTGAGGCTTAGGGGGTGGAGGG - Intergenic
1001636210 5:173212104-173212126 ACTGAGGCTCAGAAAGGTGATGG - Intergenic
1001645575 5:173279393-173279415 ACTGAGGCTCAGAGACAGGAAGG - Intergenic
1001826126 5:174746474-174746496 ACTGAGGCCCAGATAGGGGAAGG + Intergenic
1001949952 5:175809347-175809369 ACTGAAGCTCAGAGAGTGAAAGG + Intronic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1001995478 5:176153989-176154011 GCTGAGGCTCAGGCAGTGGCAGG - Intergenic
1002290269 5:178195629-178195651 ACTGAGGCTCAATCTGGGCACGG + Intergenic
1004014552 6:11720161-11720183 AAGGGGGCTCAGGCTGTGGAAGG + Intronic
1004369398 6:15039091-15039113 AATGAGGCTCAGAGAATGGATGG - Intergenic
1004772564 6:18800636-18800658 GGTGTGGCACAGACTGTGGAAGG + Intergenic
1005691484 6:28311233-28311255 ACGGAGGATCAGACAGTGGGTGG + Intergenic
1005692799 6:28323422-28323444 AGGAAGGCTCAGACTGTGGATGG - Intergenic
1006174506 6:32113900-32113922 ACTAAGGCTCAGAATGTTTAAGG + Intronic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1007378362 6:41471155-41471177 ACTGAGGCCTAACCTGTGGACGG + Intergenic
1007398655 6:41591335-41591357 ACTGGGGCCCAGAAGGTGGAAGG - Intronic
1010091407 6:71986948-71986970 ACTGATGCTCAGGGTGTAGATGG + Intronic
1010895252 6:81354761-81354783 AATTAGGCTAAGACTGTGCATGG - Intergenic
1011500382 6:87981969-87981991 TGAGAGGATCAGACTGTGGAGGG + Intergenic
1012866292 6:104622459-104622481 ACTGAGGCTCAGAGAGTAAAGGG + Intergenic
1012980068 6:105819916-105819938 GCTGAAGCTCAGAATGAGGATGG + Intergenic
1013164415 6:107576762-107576784 ACTGAGGCTTAGCATATGGACGG + Intronic
1017246092 6:152226817-152226839 GCTGAACCTCAGACTGTGGAGGG + Intronic
1018799423 6:167210690-167210712 ACTTGGCCTCAGCCTGTGGAGGG - Intergenic
1018813479 6:167314456-167314478 ACTTCGCCTCAGGCTGTGGAGGG + Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1019165530 6:170095433-170095455 ACTGAGGCACTGACCGGGGAGGG + Intergenic
1019379047 7:711975-711997 GATGAGGGTGAGACTGTGGATGG + Intronic
1019498024 7:1349543-1349565 ACTGAGGCTCAAAGAGGGGAGGG - Intergenic
1019864893 7:3698499-3698521 ACTGACGCTCTGAGTGAGGAGGG - Intronic
1020399934 7:7764476-7764498 GATGAAGCTGAGACTGTGGAAGG + Intronic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1023868849 7:44252073-44252095 TCCGAGACTCAGACTGAGGAGGG + Intronic
1024794614 7:53006501-53006523 AATGATGCTCACATTGTGGAGGG + Intergenic
1025062602 7:55823541-55823563 ACAGTGGCTCAGCCTGTGGCTGG - Intronic
1025851830 7:65250613-65250635 ACTGGGGCTAAGACTGTGACCGG + Intergenic
1026869278 7:73840915-73840937 ACTGTGGCTCACACTATGGGAGG - Intronic
1026978866 7:74515156-74515178 ACTGAGGCTCAGAGAGAGAAGGG + Intronic
1027164106 7:75822541-75822563 ACTGAGGTTCAGGCTGGGCATGG + Intronic
1031895633 7:127345657-127345679 AGTAAGGGTCAGACTGTGCAAGG + Intergenic
1033439431 7:141365467-141365489 ACTGAGGCTCAGAGGGGTGAAGG - Intronic
1034441891 7:151089882-151089904 ACTGAGGCTCAGAGAAGGGAGGG + Intronic
1037260231 8:17000712-17000734 ACTAAGCCTCAGACTGATGAAGG + Intronic
1037692961 8:21198173-21198195 GCTGAGGCTCAAATTGTGTACGG + Intergenic
1037878816 8:22562686-22562708 ACAGAGGCTCAGACTGAGTGAGG - Intronic
1041568638 8:59310262-59310284 ACTGAGGCTCAGCCAGTGGAAGG + Intergenic
1042903832 8:73753497-73753519 ACTGTGGCTCACACTTTGGGAGG - Intronic
1045034943 8:98169583-98169605 ACTGAGGCTCAGAGAGTGGAAGG - Intergenic
1045392703 8:101731302-101731324 ACTGAGGCTGAGCCAGTGCAGGG + Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046694699 8:117326691-117326713 ACTGAAGCTCAGAGAGTGTAAGG - Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1048396375 8:134018004-134018026 GCAGAGGCTCAGACTGTGCAGGG + Intergenic
1048732827 8:137462812-137462834 ACTGAGGATCGGATGGTGGAAGG - Intergenic
1049195644 8:141314245-141314267 ACTGAGGCTCAGGGAGGGGATGG - Intergenic
1049204088 8:141355319-141355341 ACTGAGGCTCAGAGGGAGAAAGG - Intergenic
1049205433 8:141361410-141361432 ACTGAGGCTCAGAGACTGTAAGG - Intronic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050482046 9:6097483-6097505 TCTGAGGCTCAGAATGGGGAAGG - Intergenic
1051818154 9:21133860-21133882 AAGGAGGCTCTGACTGAGGAAGG - Intergenic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1053267859 9:36728875-36728897 AGTGAGGCCCAGACAGGGGAAGG - Intergenic
1053283920 9:36838558-36838580 ACTGAGGCCCAGCTTGGGGAAGG - Exonic
1053294840 9:36905396-36905418 ACTGAGGTTCAGAGAGGGGAAGG + Intronic
1053307206 9:36993532-36993554 ACTGAGGCCCAGACAGAGAAAGG + Intronic
1053419550 9:37968841-37968863 ACTAAGGCTCAGAGTGGAGAAGG - Intronic
1053451988 9:38201359-38201381 ACTGAGGCCCAGACACAGGAAGG + Intergenic
1055658310 9:78474487-78474509 ACTGAGCCACTGACTGTAGAAGG - Intergenic
1056442210 9:86632551-86632573 ACTGTGGCTCAGACTCGGGAAGG + Intergenic
1056872906 9:90301730-90301752 ACTAAGGCTCAGATTTTGAAGGG - Intergenic
1057189834 9:93080667-93080689 CCTCAGGCTCTGACAGTGGAGGG - Intronic
1057748691 9:97772595-97772617 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1058528862 9:105886349-105886371 AGTTGGGCTCAGACTGTAGAGGG - Intergenic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1058734247 9:107879437-107879459 ACTGAGGCCCAGAGGGTTGAGGG + Intergenic
1058993173 9:110274334-110274356 CCTGAGGCCCAGACTTTAGAAGG + Intergenic
1059335148 9:113564480-113564502 ACCGAGGCTCAGAGAGGGGAAGG + Intronic
1059422619 9:114201648-114201670 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1059600949 9:115778095-115778117 ACTGAGGCTCAGAATATAGAAGG + Intergenic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1060112325 9:120915008-120915030 ACTGAGGCTCACAGAGGGGAAGG + Intronic
1060153097 9:121301045-121301067 ACTGAGGCTCAAAGAGGGGAGGG - Intronic
1060264832 9:122105487-122105509 ACTGAGGCTGAGACAAAGGAAGG + Intergenic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1060364921 9:123001687-123001709 ACTGAGACTCAGAGAGTTGAGGG - Intronic
1060976780 9:127769822-127769844 ACTGAGACTCAGAGAGGGGAAGG - Intronic
1060992141 9:127855195-127855217 ACTGAAGCTCAGGCTAGGGAGGG + Intergenic
1061087659 9:128408780-128408802 ACTGAGGCCCACAGTGGGGAAGG + Intergenic
1061195188 9:129103521-129103543 ACAGAGGCCCAGAGTGGGGAAGG - Intronic
1061320942 9:129829034-129829056 ACTGAGGCTTAGAAAGGGGAAGG + Intronic
1061374711 9:130217110-130217132 ACTGAGGCTCAGACAGGTGAGGG + Intronic
1061382133 9:130265118-130265140 ACTGAGGCTCAGAGAGGTGAAGG - Intergenic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061407828 9:130402559-130402581 ACTGAGGTCCAGAGAGTGGAAGG + Intronic
1061699082 9:132401707-132401729 AGTGAGGTTGGGACTGTGGAAGG - Exonic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061930867 9:133832449-133832471 ACTGAGGCTCAGAGAGGGCAGGG - Intronic
1062129066 9:134882992-134883014 ACTGAGGCTCAGAGAGTCCAGGG + Intronic
1062445807 9:136593767-136593789 AATGAGGCCCCAACTGTGGATGG + Intergenic
1062622066 9:137427661-137427683 AAGGAGGCTCAGAGTTTGGAGGG + Intronic
1062697315 9:137882002-137882024 CTTCAGGCTCAGACTGTGGCTGG + Intronic
1187740814 X:22353604-22353626 TCTGAGGCTCAGACTGTCTGGGG + Intergenic
1187877670 X:23817413-23817435 ACTGATGCTCAGAGTGGAGAGGG + Intergenic
1188437827 X:30182632-30182654 ACTGAGGCACAGAATGTTTATGG - Intergenic
1189262843 X:39690037-39690059 GCTGAGGTTCTGCCTGTGGAAGG + Intergenic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1189829027 X:44951615-44951637 ACTGAGGCTAAGTCTGGGAATGG + Intronic
1190714895 X:53094713-53094735 ACTGAGGCCCAGGCTGGTGAAGG - Intergenic
1190741597 X:53292369-53292391 ACTGAGGCTCAGACTCAGAGAGG - Intronic
1191710793 X:64148492-64148514 ATGAAGGCTCAGGCTGTGGAGGG - Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1192554539 X:72079455-72079477 ACTGAGGCTCAGAAAGGGAAAGG - Intergenic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1195111771 X:101657254-101657276 GCTGAGGCTCAGAGTGGGGCAGG - Exonic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195757791 X:108216354-108216376 ACTGAGGCTCAAGCTGGGGAAGG - Intronic
1198015042 X:132602012-132602034 ACTGAAGCTCAGAATTGGGATGG - Intergenic
1199266518 X:145834118-145834140 ACTGAGGCTCAGAGAAGGGAAGG - Intergenic
1199482364 X:148311558-148311580 ACTGAGACTCAGAGAGTTGAAGG + Intergenic
1199710095 X:150462897-150462919 ACTGAGGCCCCGAGTGTGAAAGG + Intronic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1201940374 Y:19452340-19452362 ACAGAGGCACAGACTGCGGGAGG + Intergenic