ID: 1173957282

View in Genome Browser
Species Human (GRCh38)
Location 20:47043439-47043461
Sequence AAGCCAGTCCTGCTTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173957279_1173957282 -1 Left 1173957279 20:47043417-47043439 CCAAGGACTGGAAGTAGCCCTGA 0: 1
1: 2
2: 0
3: 14
4: 186
Right 1173957282 20:47043439-47043461 AAGCCAGTCCTGCTTCTCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 289
1173957278_1173957282 8 Left 1173957278 20:47043408-47043430 CCAACACAGCCAAGGACTGGAAG 0: 1
1: 0
2: 5
3: 27
4: 223
Right 1173957282 20:47043439-47043461 AAGCCAGTCCTGCTTCTCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 289
1173957276_1173957282 12 Left 1173957276 20:47043404-47043426 CCTTCCAACACAGCCAAGGACTG 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1173957282 20:47043439-47043461 AAGCCAGTCCTGCTTCTCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173957282 Original CRISPR AAGCCAGTCCTGCTTCTCCC TGG Intronic
900666245 1:3817416-3817438 GACACAGCCCTGCTTCTCCCTGG + Intronic
900721680 1:4180203-4180225 TGGCCAGTCCTGTTCCTCCCTGG - Intergenic
901507118 1:9691801-9691823 AAGCCATTCCTTCTTTTCCCAGG - Intronic
902548382 1:17204923-17204945 AGGTGAGTCCTGCTTCGCCCGGG + Intergenic
902953832 1:19910767-19910789 ATGCCTGCCCTGCTTCCCCCAGG + Exonic
903287575 1:22286434-22286456 ATCCCAGCCCTGCTGCTCCCGGG - Intergenic
903698963 1:25232211-25232233 AAGCCAGTTCTCCTTGTCGCAGG - Exonic
905238832 1:36569604-36569626 TCGCTAGTCCTGCTTCGCCCTGG + Intergenic
905457416 1:38097615-38097637 CAGCCAGTCCTGCTGCACACCGG + Intergenic
906634201 1:47397369-47397391 AGGACAGTCCAGCTTCTCCCAGG + Intergenic
907539207 1:55196879-55196901 ATGCCAGCCCTGCTGCTACCCGG + Intronic
909898322 1:81102134-81102156 AAGGCAACCCTGCTTCTCTCAGG - Intergenic
909994748 1:82265714-82265736 AAGCCAGTCCAGTTTCTTCTTGG + Intergenic
910161318 1:84275718-84275740 AATCCTGTCATGCTTCTGCCAGG - Intergenic
910785958 1:90998189-90998211 AAGCGAGTAGTGGTTCTCCCAGG + Intronic
912895512 1:113583690-113583712 AAGCCAGTCACGCTTCTCTGGGG - Intronic
915147346 1:153802871-153802893 TGGCCAGTCCTGCCCCTCCCCGG - Intergenic
915622268 1:157092917-157092939 AAGCCAGACATCCTGCTCCCAGG - Exonic
916548173 1:165826567-165826589 AGGCTAGTCCTGCCTCTCTCAGG + Intronic
917010114 1:170461715-170461737 CAGCCAGTAGTCCTTCTCCCAGG - Intergenic
917985361 1:180311628-180311650 ATGTTTGTCCTGCTTCTCCCAGG + Intronic
919839111 1:201596434-201596456 AAGCCAGTCCTGTTACTGGCTGG + Intergenic
919843499 1:201626381-201626403 ATGCCTGACCTGCTTCTCCAGGG + Intronic
920180004 1:204126772-204126794 ATGCCACTCCTGCTTCTCTGGGG + Exonic
921544603 1:216459690-216459712 TAGCCGGTCCTACTTCTTCCTGG + Intergenic
921748676 1:218767359-218767381 AAGCCTGCCCTGATTTTCCCAGG + Intergenic
1065917492 10:30365512-30365534 AAGCCATACCTGCTCCTCCTGGG + Intronic
1067028519 10:42864944-42864966 CAGACAGACCTGCTTTTCCCTGG + Intergenic
1068357703 10:55931305-55931327 AAGCCAGCCATGGTTTTCCCAGG + Intergenic
1068419890 10:56777874-56777896 AATCAAATCCTGCTTCTACCAGG - Intergenic
1068687902 10:59888352-59888374 AAGCCAGGTCTGCTTCACACAGG + Intronic
1068917064 10:62444130-62444152 AAGTCAGTCCTTCCTGTCCCTGG - Intronic
1069553717 10:69382815-69382837 ATGCCTGTCCTGCTCCTGCCAGG + Intronic
1069638065 10:69937631-69937653 CATCTAGTCCTGCTTCCCCCTGG - Exonic
1070160170 10:73861962-73861984 ACACAAATCCTGCTTCTCCCCGG + Intronic
1070985530 10:80686687-80686709 AAATCACTCCTGCTGCTCCCAGG - Intergenic
1073515580 10:104072710-104072732 TAGCAAGGGCTGCTTCTCCCAGG + Intronic
1073543312 10:104329284-104329306 AAACCAGTCCTCCTCCTCTCTGG + Intronic
1074774530 10:116757310-116757332 ATGCGAGAGCTGCTTCTCCCTGG - Intergenic
1074776692 10:116772376-116772398 GAGCCAGCCCTGCTGGTCCCAGG - Intergenic
1075119917 10:119657278-119657300 AAGCATGTCCTGCCTCTCCCTGG + Intronic
1075625894 10:123964373-123964395 CAGCCAGCCCTGCTTCTGGCAGG + Intergenic
1076009418 10:126975405-126975427 AAGCAGGGCCTGCTTCTCCCAGG + Intronic
1076754006 10:132558626-132558648 GAGCCCTTCCTCCTTCTCCCTGG + Intronic
1076906767 10:133366517-133366539 AAGGCAGTCAGTCTTCTCCCAGG + Intronic
1078391229 11:10937218-10937240 AACCCATTCCAGCTTTTCCCAGG - Intergenic
1080801960 11:35618205-35618227 CAGCCAGTCCGGCTTCCTCCAGG + Intergenic
1080875783 11:36273165-36273187 AAGCCAGCTCTGCTTCTCAGTGG - Intergenic
1081285878 11:41269550-41269572 AAGCCAGACTACCTTCTCCCTGG - Intronic
1081621239 11:44620194-44620216 AGGCCAGCCCACCTTCTCCCAGG - Exonic
1083274641 11:61589752-61589774 GAGCCATCCCTGATTCTCCCAGG + Intergenic
1083854764 11:65387169-65387191 AAGCCAGAGCTACTTCTCCAGGG - Intronic
1084215475 11:67644990-67645012 GAGCCAGACCTGCTCTTCCCCGG + Intronic
1084580792 11:70022011-70022033 GAGAGAGTCCTGCTTCTCCCTGG + Intergenic
1084684686 11:70686673-70686695 AAGGCAGTCCTGCATGGCCCAGG + Intronic
1084734785 11:71097630-71097652 AAGCACATCCTGCTTATCCCTGG - Intronic
1085386135 11:76159441-76159463 AGGCCAGGCCTCCATCTCCCCGG + Intergenic
1086412399 11:86555618-86555640 ATGCCAGTCCTGTTTCTTTCCGG - Intronic
1086826309 11:91503586-91503608 CAGTCAGTCCCTCTTCTCCCAGG - Intergenic
1087633199 11:100674936-100674958 ATGCCAGTGCTGCTACTCCCTGG - Intergenic
1089338250 11:117740466-117740488 CAGCTTGTCCTGGTTCTCCCAGG - Intronic
1089753691 11:120670199-120670221 AAGCCAGTATTATTTCTCCCTGG + Intronic
1090983743 11:131747717-131747739 CTGCCAGTCCTGCCTCTCACTGG + Intronic
1091081663 11:132674864-132674886 AATCCAGTGCTGCTTCTTCATGG + Intronic
1092241189 12:6837497-6837519 GACCCAGGCCTACTTCTCCCCGG + Exonic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1094413685 12:30195254-30195276 AATCCAAACCTGTTTCTCCCTGG + Intergenic
1094514635 12:31119675-31119697 GAGCCAGACCCACTTCTCCCCGG + Intergenic
1104959096 12:132479771-132479793 AGGCCACCCCTGCCTCTCCCTGG + Intergenic
1108682535 13:52792000-52792022 AAGCCAGTCTGGCTTCTTGCAGG + Intergenic
1111120315 13:83840125-83840147 ATGCCAGTCCTTATTCTACCAGG - Intergenic
1113083745 13:106545933-106545955 AAGCAAGTCCTAGGTCTCCCAGG - Intronic
1113893886 13:113751546-113751568 ATGCCAGACCTGGTTCTCCGAGG - Intergenic
1113911839 13:113845350-113845372 AAGAGACTCCTGCCTCTCCCAGG + Intronic
1114518947 14:23321188-23321210 ACGATATTCCTGCTTCTCCCCGG - Intronic
1116031516 14:39578277-39578299 ATGCCAGTGCTGCTGGTCCCTGG - Intergenic
1116624002 14:47242542-47242564 CAGCCAGTCCTGCTGGCCCCGGG + Intronic
1116964548 14:51000599-51000621 AAGCCAGCCCTGAGACTCCCTGG + Intronic
1117326120 14:54670482-54670504 AACCCAGTTCTGCCTCCCCCAGG - Intronic
1117812660 14:59565257-59565279 TAGCTCTTCCTGCTTCTCCCTGG + Exonic
1118643514 14:67816120-67816142 AAGCAAGTCCCGCCTTTCCCAGG - Intronic
1120821328 14:88914409-88914431 CAGGGAGTCCTGTTTCTCCCAGG - Intergenic
1120841367 14:89088169-89088191 AAGCCTTTTCTGATTCTCCCAGG - Intergenic
1120943428 14:89971179-89971201 AAGCCAATCCTGCTTGTGCATGG + Exonic
1121312096 14:92940828-92940850 AAGCCAGCACTGCTGCTCCCTGG - Exonic
1121559559 14:94864593-94864615 AAGCCAGGCCTGCGTCACCGAGG + Intergenic
1121835547 14:97088875-97088897 AAGCCAGTCCTTCCTCCTCCAGG - Intergenic
1122313837 14:100814038-100814060 ATGCCAGGCCTGCTTCTTGCTGG + Intergenic
1123607835 15:22053940-22053962 AAGGCAGTCCTGTCTCTCCTGGG + Intergenic
1124867987 15:33512726-33512748 AAGCCTGAGCTGCTTCTCCATGG + Intronic
1124975627 15:34527726-34527748 CAGCCAGTCCTGCAGCTCCTTGG - Exonic
1125833200 15:42730450-42730472 GAGCCAATCGTGCCTCTCCCAGG + Intronic
1126685251 15:51242815-51242837 ATGCCAGTCCTGCTCCTCACTGG - Exonic
1127323617 15:57872421-57872443 AAGCAAGTCCTGCTTCCCAGTGG + Intergenic
1130109371 15:80952123-80952145 AAGAGAGTCCTGCTTCTGCCTGG - Intronic
1130810137 15:87368231-87368253 AAGACAGCCCTGCTTAGCCCGGG - Intergenic
1131013408 15:89038254-89038276 AACACAGTCCTGCTTCACCCAGG + Intergenic
1132153180 15:99476550-99476572 AGGCCAGGCCTGCATCTTCCCGG - Intergenic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1202980069 15_KI270727v1_random:345738-345760 AAGGCAGTCCTGTCTCTCCTGGG + Intergenic
1132859139 16:2061470-2061492 AAGCCTTTCTTGCCTCTCCCAGG - Intronic
1132942717 16:2515997-2516019 AGGCCTTTCCTGCTTATCCCTGG + Intronic
1133198482 16:4187669-4187691 AAAACAGTCCTCCTTCTTCCAGG + Intergenic
1136471480 16:30483704-30483726 AAGCCCTTCCTGGATCTCCCAGG - Intronic
1136519312 16:30786110-30786132 CAGCCAGTCTTGCTTCACCTTGG - Intronic
1138351724 16:56349528-56349550 AAGCGAGACCTGCTCCTCCCCGG + Intronic
1138512265 16:57515517-57515539 AAACCACTCCTGCTGTTCCCTGG + Intronic
1139955502 16:70691239-70691261 GAGCCAGCCCAGCCTCTCCCGGG - Intronic
1140239828 16:73190892-73190914 AATCCAGTCCCTCTTCACCCTGG - Intergenic
1140254299 16:73321680-73321702 AGGCCAGGCCTGCCTCTCTCTGG - Intergenic
1140338893 16:74138110-74138132 AGGCCAGGGCTGCTTCTGCCTGG + Intergenic
1141996105 16:87637325-87637347 CAGCCATTCCTGCTCCTCCCCGG + Intronic
1142691177 17:1606834-1606856 TAGCCAGTGCTGGCTCTCCCAGG - Intronic
1144623757 17:16833977-16833999 CAGCCAGTCCTGTTTCTACAGGG - Intergenic
1144793262 17:17873741-17873763 TCTCCAGGCCTGCTTCTCCCTGG + Intronic
1144882673 17:18438739-18438761 CAGCCAGTCCTGTTTCTACAGGG + Intergenic
1145149561 17:20505647-20505669 CAGCCAGTCCTGTTTCTACAGGG - Intergenic
1146268722 17:31470540-31470562 CATCCATTCCTGCTTCTGCCAGG - Intronic
1148085722 17:44992758-44992780 AGGCCAGGGCTGCTGCTCCCTGG - Intergenic
1148340642 17:46871558-46871580 AAGGTAGGCCTGCTTGTCCCAGG + Intronic
1148556947 17:48584437-48584459 AAAACAGGCCTGCCTCTCCCAGG + Intronic
1150193884 17:63273778-63273800 ATGCCACTCCTGCTGGTCCCAGG - Intronic
1150286863 17:63959559-63959581 ATGCCACTCCTGCTCCTCTCAGG - Intronic
1152162886 17:78680201-78680223 AATCCACTCCTCCTTCTCCTCGG + Exonic
1153045158 18:849114-849136 AAGCCTGTCCTGCTTCCTCAGGG - Intergenic
1153515426 18:5896285-5896307 CAGCCCCTCCTGCTCCTCCCCGG + Intergenic
1153815385 18:8786067-8786089 AGGCCAGACCTGCTTCAGCCTGG + Exonic
1154161336 18:11982443-11982465 AAGCGAGTGTTGGTTCTCCCAGG + Intronic
1154363701 18:13687434-13687456 AAGCCCTTTTTGCTTCTCCCTGG - Intronic
1155174682 18:23291861-23291883 AAGCCACCACTGCTTCTCTCCGG + Intronic
1155255356 18:23992605-23992627 AAGCATGGCTTGCTTCTCCCTGG + Intergenic
1155419020 18:25633622-25633644 AAGCCTCCCCAGCTTCTCCCAGG + Intergenic
1156242184 18:35265211-35265233 AGCCCAGTTCTGCTGCTCCCTGG - Intronic
1156685415 18:39639466-39639488 AAGCCAGTCCAGTTTCACTCTGG - Intergenic
1156900162 18:42291112-42291134 AAACCAGTCCTGTGACTCCCTGG - Intergenic
1157365074 18:47057320-47057342 AAGCTAGTCCTGTCTCTCTCTGG + Intronic
1157553011 18:48594365-48594387 TAGCCAGTCCTGCTTGCTCCAGG + Intronic
1157947030 18:51991898-51991920 AAGCCTGGCCTGCATCTCCAGGG - Intergenic
1158538594 18:58331056-58331078 AGTACAGTCCTGCTTCTCCTAGG - Intronic
1159795497 18:72838124-72838146 AAGCCTGTCCTCCTTCTTCCTGG + Intronic
1159921962 18:74234788-74234810 AAGCAAGTCCTTCTTCTGCCTGG + Intergenic
1160394737 18:78563446-78563468 CAGCCCGTGCTGCTTCCCCCGGG + Intergenic
1160418732 18:78729549-78729571 AAGCCAGTCCTGCTGTCTCCTGG - Intergenic
1160786133 19:900905-900927 AACCCGCTCCTGCTCCTCCCCGG + Exonic
1160864881 19:1252118-1252140 AAGCCAGGCCCCCTTCCCCCAGG - Intronic
1161069285 19:2252404-2252426 CACCCAGGCCTGCTTCTTCCTGG + Exonic
1161389841 19:4015255-4015277 AAGCCTGCCCTGCCGCTCCCAGG - Intronic
1162660577 19:12165339-12165361 AGGTCAGCACTGCTTCTCCCTGG + Intronic
1162856248 19:13470650-13470672 AAGTCAGCCCTGCCTCTACCAGG - Intronic
1163654154 19:18536016-18536038 CAGCCACTCCTGCTGCCCCCAGG + Intronic
1164436822 19:28237556-28237578 AAGCTGGCCCTGCTTCTTCCTGG - Intergenic
1164699118 19:30269870-30269892 AAGGCAGTCCCGCTTCTAGCTGG + Intronic
1166665486 19:44677473-44677495 GAGACAGTCCTGTTTCCCCCAGG + Intronic
1167118020 19:47499370-47499392 AAGCCTTTCCTTCTGCTCCCTGG - Intronic
1167358341 19:49017215-49017237 GAGCCACTCCTGCGCCTCCCTGG - Intergenic
925224478 2:2171110-2171132 AATCCTGTCCTGCTTTGCCCTGG - Intronic
925629105 2:5870582-5870604 AAGCCAGTCATGTTTTTTCCAGG + Intergenic
926885171 2:17590614-17590636 AAGCCACTCTTGCTACTTCCAGG - Intronic
927935579 2:27074191-27074213 AACCCAGTTCCCCTTCTCCCAGG - Intergenic
928427159 2:31188862-31188884 AAGCCACTCCTGCTTCCCCCAGG + Intronic
929757649 2:44780542-44780564 CAGCCAGAGCTGCATCTCCCAGG - Intergenic
930024280 2:47020876-47020898 AAGCCAGTGCTGCCCCTGCCCGG - Intronic
931966841 2:67544395-67544417 GAGGCAGTTCTGCTTCTCCCTGG - Intergenic
932401202 2:71482242-71482264 AAGCGAGTCTTCCTGCTCCCTGG - Intronic
933054252 2:77642508-77642530 GAGCCAGTCCTCATTCTCCCAGG + Intergenic
933721724 2:85401462-85401484 GAGCCAGCCCTGCTTCTGGCTGG - Intronic
933811936 2:86038069-86038091 AAGCCCATCCTCCTGCTCCCCGG + Intronic
934606584 2:95699794-95699816 ATGCCAAGCCTGCTTCTCCCAGG + Intergenic
935854013 2:107255868-107255890 AAGCCAATCCCCCTTCCCCCCGG + Intergenic
936539988 2:113341922-113341944 ATGCCAAGCCTGCTTCTCCCAGG + Intergenic
937362593 2:121239320-121239342 AAGCCAGTCCTGGTTTCACCAGG + Intronic
940509179 2:154591057-154591079 CAGCTAGTCCTGTTTCTCACTGG - Intergenic
941978954 2:171434221-171434243 GAGGCAGCCCGGCTTCTCCCAGG - Intronic
942543412 2:177038063-177038085 AAGCCTTTCCTGCTGCTCCATGG - Intergenic
943075306 2:183187370-183187392 AAGCCCTTTTTGCTTCTCCCTGG - Intergenic
944510006 2:200455426-200455448 AAGCCAGGCTTGCTCCTCCTGGG + Intronic
945075184 2:206031675-206031697 AATCCAGTCCTGCCTCTCATCGG - Intronic
946192020 2:218012580-218012602 AAGCCAGGCCTGCCACTGCCTGG + Intergenic
946914127 2:224498712-224498734 TAGACAGTCCTGCTTCACCCTGG - Intronic
1168799514 20:635251-635273 ATGCCAGCCCTGCTGGTCCCTGG - Intergenic
1169092262 20:2868181-2868203 AAGGCAGTCCAGATTCTACCTGG - Intronic
1169145866 20:3252023-3252045 AAGGCTGTGCTGCTCCTCCCAGG + Exonic
1169248948 20:4045820-4045842 AAGCCTGTCCTGCTTATCTCAGG + Intergenic
1169668805 20:8071461-8071483 AAGCCAGCCCTGCTCCTCAAAGG - Intergenic
1173437450 20:43045791-43045813 ATGCGTGTCCTTCTTCTCCCAGG - Intronic
1173467586 20:43295628-43295650 GGGCAAGCCCTGCTTCTCCCTGG - Intergenic
1173549672 20:43923855-43923877 AGGCCAGGCCAGCTTCTCCCCGG - Intronic
1173957282 20:47043439-47043461 AAGCCAGTCCTGCTTCTCCCTGG + Intronic
1174114226 20:48215802-48215824 AGCCCAGTCCTGCCTCTCCCAGG + Intergenic
1175297114 20:57916072-57916094 AATCAAGTCCTGATTCTCGCTGG - Intergenic
1175519437 20:59590598-59590620 ACGCCAGCCCTCCTGCTCCCTGG + Intronic
1175551522 20:59820965-59820987 CACACAGTCCTGCTTCACCCAGG + Intronic
1176231578 20:64035839-64035861 CAGCAAGTGCTGCCTCTCCCAGG - Intronic
1178594821 21:33943696-33943718 AATCAAGTCCTGCTACTGCCAGG + Intergenic
1179457035 21:41507336-41507358 GAGCCAGACCGGCTCCTCCCGGG + Intronic
1180941991 22:19665718-19665740 CAGCCAGCCCAGCTTCTCCCAGG - Intergenic
1181009603 22:20032671-20032693 AAGCCAGGCACGATTCTCCCTGG + Intronic
1182087845 22:27573772-27573794 GAGCCAGGCCTGCTTCTCTGGGG - Intergenic
1182268142 22:29135401-29135423 AAGCAAATCCTGTTACTCCCAGG - Intronic
1182524363 22:30906296-30906318 ATGCCAGTCTTGCTTCTCCTTGG - Exonic
1183036347 22:35143764-35143786 TAGCCATTCCTGCATCCCCCAGG + Intergenic
1184552244 22:45210586-45210608 AGGCCAGTCTTGTTTTTCCCTGG - Intronic
1185227040 22:49659139-49659161 AAACCAGTGCTGCTGGTCCCAGG + Intergenic
1185274151 22:49943190-49943212 AGGCCAGCCCTCCTTCCCCCGGG - Intergenic
949159389 3:861407-861429 AAGAAACTCCTGCTCCTCCCAGG + Intergenic
952744555 3:36764620-36764642 AAGGCGGTCCCGCCTCTCCCCGG + Intergenic
954136557 3:48584676-48584698 GGGGCAGTCCTGCTCCTCCCTGG + Intronic
954457161 3:50606038-50606060 AAGTCAGGGCTGGTTCTCCCAGG - Intergenic
956001962 3:64739163-64739185 GAGTCAGTTCTGCTTCTCCAAGG - Intergenic
957017120 3:75079655-75079677 AAGCCCTCCCTGATTCTCCCAGG - Intergenic
957915456 3:86682691-86682713 AAGCCAGTCTTGGTGCTCCAGGG - Intergenic
957959461 3:87230623-87230645 AACCCACTCCTGACTCTCCCTGG + Intronic
960228244 3:115192673-115192695 AAGACATGCCTGCTTCTCCTTGG + Intergenic
960674309 3:120179906-120179928 AAGCAAGGACTGTTTCTCCCTGG - Intronic
961431243 3:126885081-126885103 AAGCCAGTTCTGAGACTCCCAGG + Intronic
961713267 3:128843012-128843034 AAGCCAGGCCTGCTTCCCACAGG + Intergenic
963308315 3:143678985-143679007 AAAACAGTGCTCCTTCTCCCTGG - Intronic
966534267 3:181014525-181014547 ATTCCATTCCTGGTTCTCCCAGG + Intergenic
967761035 3:193226592-193226614 GAGAAATTCCTGCTTCTCCCTGG + Intergenic
968318279 3:197742738-197742760 CAGGCATTCCTCCTTCTCCCAGG - Intronic
968724182 4:2234485-2234507 GAGCCAGTTCTGATTTTCCCAGG - Intronic
968881065 4:3300462-3300484 CAGGCAGTCCTCCTCCTCCCAGG - Intronic
969354032 4:6614667-6614689 CTGCCAGTCCTACTTCTTCCAGG + Intronic
969489449 4:7490828-7490850 CTCCCAGGCCTGCTTCTCCCTGG + Intronic
969687789 4:8685920-8685942 AAGCCGGCCCTGCATCTCCTGGG + Intergenic
970000117 4:11356487-11356509 CAAGCAGTCCTGCTTCTACCTGG + Intergenic
970242817 4:14027239-14027261 AAAACAGTGCTGCTTCTCCTTGG + Intergenic
971786206 4:31106151-31106173 AAGGCAGTCCTCCCTCTTCCAGG + Intronic
971840640 4:31847727-31847749 AAGCCCTTTCTGTTTCTCCCTGG - Intergenic
972059869 4:34855865-34855887 AGTCCAGTTCTGCCTCTCCCTGG - Intergenic
975865936 4:78723754-78723776 AAGCGATTCTTGATTCTCCCAGG + Intergenic
976441444 4:85080286-85080308 ATTCCATTCCTGATTCTCCCTGG + Intergenic
976555122 4:86441825-86441847 AAGCCTCTCCTGCTGCTTCCTGG + Intronic
977176999 4:93829731-93829753 AAGCGAGTCCGGCAACTCCCGGG - Exonic
977213389 4:94247393-94247415 ATGCCAGCTCTGCTTATCCCTGG - Intronic
978080746 4:104588310-104588332 CAGTCAGGCCTGCATCTCCCAGG - Intergenic
978719442 4:111890121-111890143 TAGGCATTCCTGCTACTCCCTGG - Intergenic
980582892 4:134775526-134775548 AAGACAGTGCTGATTCTCCTTGG - Intergenic
982573381 4:157076907-157076929 AAGCCAGAGGGGCTTCTCCCTGG - Intronic
984414956 4:179446320-179446342 AAGAAGGTCCTGCTTCTCCTTGG + Intergenic
984429049 4:179625118-179625140 AAGTCCTTCCTCCTTCTCCCAGG + Intergenic
985496012 5:206527-206549 AGGCCAGCCCTGCTGCTCCTTGG - Intronic
985832033 5:2240880-2240902 AATCCCCTCCTGCTTCTGCCGGG + Intergenic
986492004 5:8302688-8302710 AAGGCAGCCTTGCTTCTCCATGG + Intergenic
988200880 5:28066857-28066879 CAGCCAGTCCTGTTTCTGCCAGG + Intergenic
988718639 5:33853887-33853909 ATGCCAATCCTGCTGGTCCCTGG + Intronic
990539772 5:56760727-56760749 AGGCCAGTGCTGCTTCATCCTGG - Intergenic
992747196 5:79831456-79831478 CAGGCACTCCTGCTTCTCCTGGG + Intergenic
994603934 5:101943043-101943065 AAGCCAGGCCAGTTTCTCCCTGG - Intergenic
997215107 5:132103577-132103599 AAGCCAGTGCTGATTTTTCCTGG - Intergenic
997279357 5:132629342-132629364 AAGCCCTTCCTTCTTATCCCAGG - Intronic
999182492 5:149679999-149680021 AAGACAGTTCTACATCTCCCTGG + Intergenic
999314361 5:150574532-150574554 ATCCCAGTTCTGCCTCTCCCTGG + Intergenic
1001935450 5:175700292-175700314 GAGGCAGTCCAGCTTCTCCCCGG - Intergenic
1002880004 6:1242840-1242862 AGGGCTGTGCTGCTTCTCCCAGG + Intergenic
1004264294 6:14135437-14135459 AGGCCACTGCTGCTTCTCCATGG + Exonic
1004959516 6:20770912-20770934 AAGCCTTTCCTGATTTTCCCTGG + Intronic
1006033356 6:31193758-31193780 ATGCCAGTGCTGTTTGTCCCAGG - Intergenic
1006056613 6:31389754-31389776 ATGCCAATGCTGCTTCCCCCAGG - Intergenic
1006069337 6:31486733-31486755 ATGCCAATGCTGCTTCCCCCAGG - Intergenic
1008080169 6:47186257-47186279 AAGCCAGTGCTTTTTCACCCTGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1008843559 6:55934701-55934723 AAGCCCATTCTGCTTCTGCCCGG - Intergenic
1011673766 6:89710751-89710773 AAGCCAGTGCTGCATCTCTCAGG - Exonic
1012259186 6:97067804-97067826 AGGCCAGGCCTGTTCCTCCCTGG + Intronic
1015868659 6:137753761-137753783 CAGCCTGTCCTGCCTCTTCCAGG - Intergenic
1017770802 6:157643093-157643115 GAGGGAGTCATGCTTCTCCCTGG + Intronic
1018722023 6:166580410-166580432 AAGACAATGCTGCTTCTTCCAGG - Intronic
1019025715 6:168961275-168961297 AAAGCAGTCCTGCTTCTCAAAGG + Intergenic
1019857926 7:3627894-3627916 TTTCCAGTCCTGTTTCTCCCAGG + Intronic
1020194381 7:6026055-6026077 AGGCCACCCCTGCCTCTCCCCGG + Intronic
1020966754 7:14879709-14879731 AAGCCATTCATTCTTCTCCATGG + Intronic
1021573549 7:22087998-22088020 ACGCCAGGCCTGCTTGGCCCCGG + Intergenic
1024181288 7:46897640-46897662 AAGTCAGTCTTCCTCCTCCCGGG - Intergenic
1024674403 7:51624983-51625005 CAGTCAGTCCTCCATCTCCCTGG - Intergenic
1025708957 7:63890593-63890615 AAGCCTGTCCTCCGACTCCCTGG - Intergenic
1030673320 7:112361260-112361282 ATGCCAGCCATTCTTCTCCCTGG + Intergenic
1032453155 7:132052000-132052022 AAGTCACTCCTGCTGCTCCTGGG - Intergenic
1034270665 7:149802173-149802195 AAGCCAGTCCTGCTTTGTGCAGG + Intergenic
1034855458 7:154541919-154541941 AAGCCATCCTTCCTTCTCCCTGG - Intronic
1035313907 7:157986503-157986525 AGGCCATGCCTGCCTCTCCCAGG + Intronic
1035907378 8:3527978-3528000 ACGCCAGTCGTACTTCTCCCTGG + Intronic
1036136434 8:6165859-6165881 AACCCAGACAAGCTTCTCCCTGG - Intergenic
1037220214 8:16509968-16509990 AAGCAGATCCTTCTTCTCCCAGG + Intronic
1037837695 8:22223963-22223985 AACCCAGACCTCATTCTCCCAGG + Intronic
1041098984 8:54377952-54377974 TGCCCAGTCCTGCTTCTCCCTGG + Intergenic
1041813727 8:61942146-61942168 AAGCCAATCAAGCTTCTTCCTGG - Intergenic
1042559035 8:70058685-70058707 AAGCCGGTCCCGCTTCTCAAAGG + Exonic
1042950812 8:74199111-74199133 ATGCCAGCCCTGCTGGTCCCTGG + Intergenic
1043420631 8:80094910-80094932 TAACCAGGCCTGCCTCTCCCAGG - Intronic
1045069385 8:98485439-98485461 AAGACAGTCCTTCTTCTCAAAGG + Intronic
1047879527 8:129178328-129178350 TAGCCAAGCCTTCTTCTCCCAGG + Intergenic
1049030645 8:140034923-140034945 AACCCAGGCCTGCTTCTTCAGGG - Intronic
1049203526 8:141352929-141352951 AGGCCAGTGCTCCCTCTCCCTGG + Intergenic
1054827719 9:69589912-69589934 AAGCCCCTCCTGCTTCTCTATGG + Intronic
1054916284 9:70497909-70497931 ATGCCAAGCCTGCTTCTGCCTGG - Intergenic
1056688155 9:88783763-88783785 AGGCCAGTCCTGCCTCCTCCAGG - Intergenic
1056891859 9:90501851-90501873 AAGCTATTGCTGCTTCTCCAGGG + Intergenic
1057143951 9:92746040-92746062 AAGCCAGTCATGGTGGTCCCTGG + Intronic
1057218821 9:93244717-93244739 CAGCCAGACCTGCTTGGCCCGGG - Intronic
1057543877 9:96001980-96002002 CAGCCAGCCCTGCTGGTCCCCGG - Intronic
1058919893 9:109603516-109603538 AAGCCAGTCCCTCCTCTCCAGGG + Intergenic
1059013278 9:110486431-110486453 AAGCCAGGAATGCTTCTCCTTGG - Intronic
1059351314 9:113667283-113667305 AAGCAGGTCCAGCTTCTCTCGGG + Intergenic
1059433133 9:114261557-114261579 AAGCCAAGCCAGCTTCTCCCGGG + Intronic
1059437130 9:114283732-114283754 CAGCCAGTCCCGGTTCTCCTTGG - Exonic
1060189220 9:121581714-121581736 CAGCCTCTCCTGCCTCTCCCTGG - Intronic
1060818500 9:126648383-126648405 GAGCCTGGCCTGGTTCTCCCAGG - Intronic
1061118367 9:128628533-128628555 AGCCCAGCCCTGCTCCTCCCTGG - Intronic
1061951467 9:133938616-133938638 GAGACAGTTCTGCTTGTCCCGGG + Intronic
1061973113 9:134055313-134055335 AAGCGAGTCCTGCCCCACCCTGG + Intronic
1062193095 9:135257647-135257669 AAATCCCTCCTGCTTCTCCCAGG - Intergenic
1185566250 X:1097613-1097635 CAGCCATTCCTGCTTCTTGCTGG + Intergenic
1186766165 X:12772600-12772622 AAGCCAGTGCTGTTTCTCCTGGG + Intergenic
1187687097 X:21826574-21826596 ATGCCACTCCTGCTGGTCCCAGG - Intergenic
1188328479 X:28837594-28837616 AAGCCTCTCCTGCTTCTCCTGGG - Intronic
1189558626 X:42170255-42170277 AAAGGAGTCCTGCGTCTCCCAGG + Intergenic
1189995201 X:46631164-46631186 AAGGCATTCCTGTTTCTCCAGGG - Intronic
1190903140 X:54698118-54698140 AAGACAGTAGTGGTTCTCCCAGG + Intergenic
1191008759 X:55738979-55739001 GAGTCAGTTGTGCTTCTCCCTGG - Intronic
1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG + Intergenic
1195086400 X:101418184-101418206 AATCCATCCCTCCTTCTCCCCGG + Intergenic
1196687678 X:118526156-118526178 AAGCCAGACCTGCTGACCCCAGG - Intronic
1200691891 Y:6314193-6314215 AAGATATTCCTTCTTCTCCCTGG + Intergenic
1201043381 Y:9860530-9860552 AAGATATTCCTTCTTCTCCCTGG - Intergenic