ID: 1173961144

View in Genome Browser
Species Human (GRCh38)
Location 20:47073600-47073622
Sequence GATACAATAGTGACCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173961141_1173961144 1 Left 1173961141 20:47073576-47073598 CCAGGCACTGTTTCAGGTGCAGA 0: 1
1: 2
2: 23
3: 127
4: 742
Right 1173961144 20:47073600-47073622 GATACAATAGTGACCAGGACAGG 0: 1
1: 0
2: 2
3: 33
4: 170
1173961138_1173961144 28 Left 1173961138 20:47073549-47073571 CCAGTATTTGTTGAGTTACTGCA 0: 1
1: 0
2: 3
3: 14
4: 209
Right 1173961144 20:47073600-47073622 GATACAATAGTGACCAGGACAGG 0: 1
1: 0
2: 2
3: 33
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173961144 Original CRISPR GATACAATAGTGACCAGGAC AGG Intronic
901302922 1:8212674-8212696 GATGCAAAAGTGAACAGAACGGG + Intergenic
903283752 1:22264635-22264657 GATAACACAGAGACCAGGACGGG + Intergenic
904098381 1:28000632-28000654 GATACAATGCTGACCAGGCAAGG + Intronic
904183032 1:28680398-28680420 GCTACCACAGTGCCCAGGACAGG - Intronic
905314359 1:37072129-37072151 GACACAATGGTGAACAAGACGGG - Intergenic
905337853 1:37257718-37257740 GATAAAATGGAGACCAGGATGGG + Intergenic
905342073 1:37286181-37286203 GACACAACAGTGAACAGGACGGG - Intergenic
906789787 1:48648705-48648727 CATACAACAGTGACCAAGAAAGG - Intronic
910079645 1:83326414-83326436 GATAGATGAGTGACCAGGACTGG - Intergenic
911499978 1:98673572-98673594 GATACAATAGTGGTCAAGACTGG - Intronic
912691723 1:111809796-111809818 GATTCAAAAATGACCAAGACAGG + Intronic
913414094 1:118586031-118586053 GATTCCATAGTGAACAAGACAGG + Intergenic
915483386 1:156202893-156202915 GGTACAATAGTGAACAGAAACGG - Intronic
918190212 1:182166484-182166506 GATTGAGTAGTGACCAGAACCGG + Intergenic
918590412 1:186234908-186234930 GCTACAAGAGTGACTAGGAATGG - Intergenic
921480461 1:215659040-215659062 GATACAACAGTGAACAAGGCTGG + Intronic
922646254 1:227289612-227289634 GATACAACAGTGAACGAGACAGG - Intronic
1065970490 10:30802389-30802411 AATACAAAAGTGAGCAGGACTGG + Intergenic
1066068988 10:31785992-31786014 AATAAAATAGTGACCTGGAGTGG + Intergenic
1069312652 10:67057701-67057723 GGTAAAATGGTGATCAGGACAGG - Intronic
1072985062 10:100132247-100132269 GAGTCAATAGTTACCAGGAAAGG + Intergenic
1074878094 10:117630144-117630166 GACACAATAGTAACCATCACAGG + Intergenic
1078468038 11:11564874-11564896 GATACCATAGTGAACAGAATAGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079757986 11:24289947-24289969 GTTACAATAGTACCCATGACTGG - Intergenic
1079889641 11:26034851-26034873 GATATAATAGTGAAGAAGACAGG - Intergenic
1080344830 11:31312656-31312678 GAAACAAGAGTGACCAGAACAGG - Intronic
1080888245 11:36386387-36386409 GATACAATAGTGAACAAGACGGG + Intronic
1082031398 11:47606890-47606912 GAGACTGTAGTTACCAGGACAGG + Intergenic
1082222933 11:49663599-49663621 GATACATTTGGGACAAGGACAGG + Intergenic
1088949614 11:114554232-114554254 AATACAATAGAGGCCAGGAAAGG - Intronic
1089153319 11:116381754-116381776 GATACAATAGTGAACAAAAAGGG - Intergenic
1089345923 11:117791692-117791714 GACAGAGTAGTGGCCAGGACAGG - Intronic
1089422668 11:118343395-118343417 GATACAGCAGTGAGCAAGACAGG - Intergenic
1089636092 11:119812834-119812856 GGTACGATAGTGAACAAGACAGG + Intergenic
1093745317 12:22734150-22734172 GATCCAAGAATGAACAGGACGGG - Intergenic
1094681644 12:32672626-32672648 GATATAATTGCAACCAGGACTGG - Intergenic
1095916408 12:47484644-47484666 GAGACAATGGGGACCAGGACAGG - Intergenic
1098577605 12:72060987-72061009 GATACAGTAGTGAACAAGATGGG - Intronic
1099141892 12:78988181-78988203 GATACAATAGTGAGCAAAATAGG + Intronic
1099396846 12:82150783-82150805 GATACTATGGTGAGCAAGACTGG - Intergenic
1099514385 12:83578717-83578739 GAAACAATGGTGACCAGACCAGG - Intergenic
1100113238 12:91271223-91271245 GATACAATAGTAAGTAGGAGAGG + Intergenic
1102461919 12:113105224-113105246 GATACAGAAGTGAACAAGACAGG - Intronic
1103333734 12:120173388-120173410 GATACTATAGTGACAAGTTCTGG + Intronic
1103812981 12:123630668-123630690 GATACATCAGTGAACAAGACAGG + Intronic
1107946683 13:45423074-45423096 AATACAGTAGTGAGCAAGACTGG - Intergenic
1108464584 13:50702074-50702096 GATCAAAAAGTGACCAGGGCTGG + Intronic
1108750284 13:53440782-53440804 GATACAATTGTGTCCAGAATTGG - Intergenic
1109394481 13:61738248-61738270 GATAAAATAGTGAATAAGACGGG + Intergenic
1110326950 13:74227374-74227396 GATACAAAAATGAACAAGACAGG - Intergenic
1110731742 13:78886653-78886675 GTTAAGATAGTTACCAGGACAGG + Intergenic
1112459973 13:99595264-99595286 GATACAATAGTGCTGATGACAGG - Intergenic
1113139603 13:107132575-107132597 TAAAAAATAATGACCAGGACAGG - Intergenic
1113661407 13:112108438-112108460 GAGACATCAGTGACCCGGACTGG - Intergenic
1116174610 14:41451346-41451368 TACACAATAGTGAACAGGAAAGG + Intergenic
1117597379 14:57337147-57337169 GATACAATTGTGGCCAGGTCAGG - Intergenic
1117998914 14:61504941-61504963 GATATAATAGTGACCACAATAGG + Intronic
1119437694 14:74608935-74608957 GATATAGCAGTGACCAAGACAGG - Intronic
1119514937 14:75240614-75240636 GATACAACTGTGGGCAGGACAGG - Intronic
1120106263 14:80498780-80498802 TATACAGCAGTGAACAGGACAGG - Intronic
1121413880 14:93765492-93765514 CTTACAATAGTGTCCAGTACAGG - Intronic
1121951638 14:98175920-98175942 GATGCAATAGTGAACAAGAGAGG + Intergenic
1122104507 14:99441904-99441926 GAAAGAAGAGTGGCCAGGACTGG + Intronic
1124170521 15:27368547-27368569 ACTACAACAATGACCAGGACAGG - Intronic
1125126586 15:36230475-36230497 GGTACAACAGTGAACAAGACAGG + Intergenic
1126170782 15:45693592-45693614 GAGACAGCAGTGACCATGACTGG + Intergenic
1126528673 15:49687854-49687876 GAGACGACAGTGAACAGGACAGG - Intergenic
1126790727 15:52218845-52218867 GAAAGAAAAGAGACCAGGACTGG + Intronic
1126970238 15:54102798-54102820 GAGACAAGAGTCACCAGAACTGG - Intronic
1127847978 15:62888061-62888083 GATACAATGATGAACAAGACAGG - Intergenic
1128005125 15:64231484-64231506 GATACAGTAGTGAACAAGATAGG - Intronic
1130516299 15:84628523-84628545 GATACATTAGTGGCCAGGCACGG + Intergenic
1130899341 15:88195340-88195362 GATACAATAGTGAATAAGACAGG - Intronic
1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG + Intergenic
1133724233 16:8522608-8522630 GAGACGATGGTGGCCAGGACTGG - Intergenic
1135138994 16:19905889-19905911 GGTGCAATAGTGTCCAGCACGGG + Intergenic
1137589721 16:49686170-49686192 CATACAACAGTGAGCTGGACAGG - Intronic
1137607204 16:49794807-49794829 GATACAACAATGAACAAGACAGG - Intronic
1141646054 16:85368412-85368434 GATACAATTCTGACCAGGCACGG + Intergenic
1144502600 17:15802178-15802200 GAGAAAACAGTGAACAGGACAGG + Intergenic
1145164777 17:20604832-20604854 GAGAAAACAGTGAACAGGACAGG + Intergenic
1146587100 17:34091706-34091728 GATTCAATAGTGCCATGGACTGG - Intronic
1147306769 17:39569566-39569588 GTTACAATAGTGTCCTGGATAGG - Intergenic
1150122465 17:62615667-62615689 AATACAGCAGTGAACAGGACAGG + Intergenic
1150161843 17:62905079-62905101 GATACAATAGTGGACAGGAGAGG - Intergenic
1152491130 17:80635455-80635477 GATACACCAGTAACCAAGACTGG + Intronic
1164850729 19:31481582-31481604 AATACAACAGTGATCAGGATGGG + Intergenic
1165066292 19:33230687-33230709 GATAAAAAAGTGAGCAGGGCCGG - Intergenic
1166538269 19:43589651-43589673 GAAACAACAGAGAACAGGACAGG + Exonic
1167243565 19:48359941-48359963 GATTCAATAGTGAACATGACAGG - Intronic
1167680854 19:50919783-50919805 GATACAATGGTGACCCTGACAGG - Intergenic
924990027 2:306377-306399 CACACAATAGTGAGCAGGCCGGG + Intergenic
925774016 2:7314792-7314814 GATTCAATATTGACTAGGAAAGG + Intergenic
925884522 2:8383124-8383146 GATACAAAGGTGAATAGGACAGG + Intergenic
925912983 2:8585354-8585376 CTTACAATAGTGACCAGCACAGG + Intergenic
929750805 2:44711321-44711343 GATACAATAGTGAACAAGATAGG + Intronic
930025672 2:47027845-47027867 GCTGCTATAGTCACCAGGACTGG + Intronic
931020895 2:58044445-58044467 GATACAGTAGTGACGAAAACAGG + Intronic
935485801 2:103651617-103651639 GAAACAATAGTGGCCAGGCGCGG - Intergenic
937099224 2:119255879-119255901 GATGCAATAGAGAACAAGACAGG + Intronic
941685298 2:168441690-168441712 GGTAGAACAGTGACCAGGACAGG + Intergenic
942087096 2:172453883-172453905 GATGCAACAGTGACAAGGACAGG + Intronic
943088766 2:183349338-183349360 GAAACAATAATGACCAGCAGAGG - Intergenic
944497290 2:200320021-200320043 GATAAAATGTTGACCAAGACAGG + Intronic
945432419 2:209779591-209779613 GATACAGCTGTCACCAGGACAGG - Intronic
947121629 2:226821289-226821311 AATGCAATAGTGACTAGTACTGG + Intergenic
948051613 2:234983111-234983133 GATACAGAAGTGAGCAGGACAGG + Intronic
1170802772 20:19604079-19604101 GATATGATGGTGACCAAGACAGG + Intronic
1173168277 20:40701426-40701448 TCTACAATAGTGACCAAGAAGGG + Intergenic
1173961144 20:47073600-47073622 GATACAATAGTGACCAGGACAGG + Intronic
1174579023 20:51557836-51557858 GATACAGTGGTGACCAAGACAGG + Intronic
1174777215 20:53355097-53355119 GATACAATAATGATCAAGACAGG + Intronic
1177101631 21:16904325-16904347 CATAAAATAGTGTCCAGGATAGG + Intergenic
1180787673 22:18556111-18556133 CATACAACAGTGCCCAGGAAAGG - Intergenic
1181234066 22:21439195-21439217 CATACAACAGTGCCCAGGAAAGG + Intronic
1181244581 22:21495636-21495658 CATACAACAGTGCCCAGGAAAGG - Intergenic
1182920465 22:34074549-34074571 GATACAGTAGTGAACAAGACGGG + Intergenic
1184608455 22:45587538-45587560 GATACAGCAGTGACCACAACTGG - Intronic
1185105118 22:48864392-48864414 GATTCTACTGTGACCAGGACTGG - Intergenic
1185165444 22:49259444-49259466 GATACAACAAAGACCAAGACAGG + Intergenic
949148711 3:737745-737767 GAAAAAATAGTAACCAGGAGAGG + Intergenic
950703575 3:14766671-14766693 GGTACACAAGAGACCAGGACTGG + Intronic
950708622 3:14799460-14799482 GATACAATAGTAATTAAGACAGG + Intergenic
951318582 3:21217312-21217334 AATACATTAATGACCAGGAAAGG + Intergenic
955221332 3:57025785-57025807 GATACATTGGTGAGTAGGACAGG - Intronic
958854930 3:99373565-99373587 GAAACAAAAGTAACCATGACAGG + Intergenic
959845642 3:111029827-111029849 GAAACAAAAGTCACCAGGAGAGG + Intergenic
960182851 3:114602621-114602643 GATACAACAGTGAGCAAAACAGG - Intronic
960376965 3:116914942-116914964 GATACAACAGTGAACAACACAGG + Intronic
960545304 3:118907351-118907373 GATAAAATAATGAACAAGACAGG + Intronic
963745883 3:149124853-149124875 GAAACAATGGTGACAGGGACTGG + Intergenic
964197895 3:154085649-154085671 AAGACAAATGTGACCAGGACTGG - Intergenic
964565874 3:158051919-158051941 GATTCAGTGGTGACCAAGACAGG - Intergenic
965600070 3:170445648-170445670 GATAGAATAAAGGCCAGGACCGG - Intronic
966903347 3:184503334-184503356 GATACAATAATGAAAAAGACAGG + Intronic
970331934 4:14995521-14995543 GATACAACAGTGAGCAAAACAGG + Intergenic
970397878 4:15689156-15689178 GATACAAAAGTGAACAAAACAGG + Exonic
970898195 4:21127591-21127613 GATACCACAGTGAACAGGACAGG - Intronic
971092845 4:23364969-23364991 AATACAATGGTGAAGAGGACAGG - Intergenic
971360560 4:25934414-25934436 GATACAGTGGTGCACAGGACAGG - Intergenic
971883899 4:32417289-32417311 AATACAATAATGACCATGAGAGG + Intergenic
972470775 4:39402155-39402177 GATAAAATATTGACCAGGCACGG + Intergenic
976076212 4:81301980-81302002 GATACACCAGTGCCCAGTACTGG - Intergenic
976782762 4:88779164-88779186 GATACAATAGTGAGAAAAACAGG - Intronic
977032649 4:91906076-91906098 GATACAAAAGTGAAAAGTACAGG - Intergenic
982144631 4:152371738-152371760 GATACATTAGTGAACAAAACAGG - Intronic
982718193 4:158830817-158830839 GACACAATGATGAACAGGACAGG - Intronic
983791769 4:171807601-171807623 GATACCATAGTGAACACCACAGG - Intergenic
984543754 4:181074097-181074119 GATACAATAGTGATAGGGACAGG + Intergenic
985531922 5:438856-438878 CTTACACGAGTGACCAGGACGGG - Intergenic
985779182 5:1861018-1861040 CATCCAATGGTGCCCAGGACAGG - Intergenic
986753073 5:10807741-10807763 GATACAGTGGTGAGCAAGACAGG + Intergenic
988445929 5:31286195-31286217 GATACAGAAGTGACCTAGACAGG + Intronic
991154432 5:63414879-63414901 GATACAATGGTGAACAAGACAGG - Intergenic
997236044 5:132272427-132272449 GGTGCAGTAGTGAGCAGGACGGG + Exonic
997603901 5:135159207-135159229 GATACAATGGTTACCAAAACAGG - Intronic
998880849 5:146643306-146643328 GATACAGTAGTGACCAAAGCAGG + Intronic
999014467 5:148084848-148084870 AATACAATAGTGACCAGAATGGG - Intronic
999534038 5:152497574-152497596 GCTACCATACTGAGCAGGACAGG + Intergenic
1000308433 5:160017902-160017924 GATACAGTGGTGAACAAGACAGG + Intronic
1000832375 5:166119128-166119150 TCTACAACAGAGACCAGGACGGG + Intergenic
1000921994 5:167149255-167149277 GATACATAAGTGAACAGGACAGG - Intergenic
1001583912 5:172820007-172820029 GATACATCAGTGAGCAGGACAGG - Intergenic
1003061979 6:2870687-2870709 GATACAGTAGTGAGCATGAATGG - Intergenic
1005513077 6:26529501-26529523 GATACAGCAGTGAAGAGGACAGG + Intergenic
1005840825 6:29743707-29743729 GAAACAAGAGAGACCAGGATGGG + Intergenic
1009565911 6:65310964-65310986 AAAACAATAGTGAACACGACAGG - Intronic
1009693210 6:67062582-67062604 AATACAAAAATGACCAGGAGCGG - Intergenic
1014452995 6:121603578-121603600 TATACCATAGTAACCAGGAGAGG + Intergenic
1016355095 6:143209911-143209933 GATACAGCAGTGAACACGACAGG - Intronic
1016974523 6:149794327-149794349 GATAAAATATTGGCCAGGAGCGG + Intronic
1018179001 6:161203810-161203832 CATATAATACTGACCTGGACAGG - Intronic
1023924844 7:44660331-44660353 AATACAATAATGACCAGCCCGGG - Intronic
1027297407 7:76791699-76791721 GATAGATGAGTGACCAGGACTGG - Intergenic
1027760618 7:82274399-82274421 GATACAGTAGTAACCAAGACAGG - Intronic
1032015279 7:128376045-128376067 AATACAAAATTGGCCAGGACAGG + Intergenic
1038798083 8:30727278-30727300 GATGCGATATTGACCAGGGCCGG - Intronic
1038955135 8:32459706-32459728 GATCAAATAGGGGCCAGGACAGG - Intronic
1040483624 8:47850094-47850116 GATGCAGTAGGGAACAGGACAGG - Intronic
1042253260 8:66777330-66777352 GATACAACAGTGAACACAACTGG - Intronic
1044426023 8:92051179-92051201 GAATCAATAGTGAGCAAGACTGG - Intronic
1047261191 8:123261492-123261514 GATGCAATGGTGACCAAGACAGG + Intronic
1047802268 8:128322402-128322424 GATACACTGGTGACCAGGACAGG - Intergenic
1051062728 9:13063673-13063695 GATACAATTGTGAACAGGGATGG - Intergenic
1051700801 9:19821477-19821499 GATACAAACGAGAACAGGACTGG + Intergenic
1055673714 9:78633399-78633421 GATACAGTAGTGAGCAAAACAGG - Intergenic
1057209369 9:93191406-93191428 GGTACCATAGTGAGCAGGACAGG + Intronic
1057589312 9:96358582-96358604 CCTTCAATAGTGACCAGGAAGGG - Intronic
1057852571 9:98576829-98576851 GATACAATGCTGAACAGGATAGG - Intronic
1058689162 9:107504754-107504776 GATATAATAGTCAGCAGGAAGGG + Intergenic
1061227103 9:129286822-129286844 GAGACAACACTGACCAGGAGGGG - Intergenic
1061531580 9:131218256-131218278 GATTCAATAGTGAAAGGGACAGG + Intronic
1062490692 9:136803536-136803558 GATACAGCAGGGACCGGGACAGG + Intronic
1186020432 X:5248998-5249020 TTTACACTATTGACCAGGACTGG + Intergenic
1187482040 X:19666378-19666400 GGTTTAATGGTGACCAGGACTGG - Intronic
1188029946 X:25253155-25253177 AATACAAGAGTGACCAACACAGG - Intergenic
1189258138 X:39656223-39656245 GATAGAATAGTGAACAAAACTGG - Intergenic
1194938086 X:99975534-99975556 AATACAATAGTGAACATGTCTGG + Intergenic
1195909825 X:109877794-109877816 GATACAAAAGAGGCCAGGAGAGG + Intergenic
1197618698 X:128722389-128722411 GATACAGTAGTGAACAAGACTGG - Intergenic
1197764028 X:130047814-130047836 GAGACAATGGTGAACAGGACAGG + Intronic
1197768156 X:130072293-130072315 GTGACACTAGTGACCAGGAGGGG - Exonic
1198076298 X:133196374-133196396 GATACAACAGTGAACAAGACAGG + Intergenic
1198209371 X:134502339-134502361 GATATAGCAGTGACCAGGACTGG - Intronic