ID: 1173961816

View in Genome Browser
Species Human (GRCh38)
Location 20:47079486-47079508
Sequence CCTTATAAGGGGTCGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173961816_1173961825 -4 Left 1173961816 20:47079486-47079508 CCTGCCCCCGACCCCTTATAAGG 0: 1
1: 0
2: 0
3: 8
4: 167
Right 1173961825 20:47079505-47079527 AAGGACTGTTGTGATTCCACTGG 0: 1
1: 0
2: 23
3: 150
4: 545
1173961816_1173961828 16 Left 1173961816 20:47079486-47079508 CCTGCCCCCGACCCCTTATAAGG 0: 1
1: 0
2: 0
3: 8
4: 167
Right 1173961828 20:47079525-47079547 TGGGCCCACTCAGAGAATCCAGG 0: 3
1: 12
2: 111
3: 366
4: 900
1173961816_1173961826 -3 Left 1173961816 20:47079486-47079508 CCTGCCCCCGACCCCTTATAAGG 0: 1
1: 0
2: 0
3: 8
4: 167
Right 1173961826 20:47079506-47079528 AGGACTGTTGTGATTCCACTGGG 0: 1
1: 0
2: 21
3: 138
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173961816 Original CRISPR CCTTATAAGGGGTCGGGGGC AGG (reversed) Intronic
900747537 1:4371431-4371453 CCTTGTCAGGGGTCATGGGCAGG + Intergenic
901022007 1:6260568-6260590 GCTTCTCAGGGGACGGGGGCGGG - Intronic
901065271 1:6491299-6491321 CCTGGGAAGGGGTCGGGGGAAGG - Intronic
902612089 1:17603306-17603328 CCTTGGAGGGGGTGGGGGGCGGG + Intronic
903492835 1:23743053-23743075 CCTTGTCAGGGGTCCCGGGCTGG - Intergenic
906581631 1:46940074-46940096 CCCTACAAGGGGAGGGGGGCGGG - Intronic
907772326 1:57478050-57478072 CCTGTTGTGGGGTCGGGGGCGGG - Intronic
909698051 1:78489696-78489718 CCTGTTAGGGGGTGGGGGGCAGG + Intronic
911259253 1:95666863-95666885 CCTTATAAGGGGTCTGAAGCTGG - Intergenic
914171203 1:145225556-145225578 CCTTTCAGGGGGTGGGGGGCTGG - Intergenic
916601060 1:166294001-166294023 CCTGATGTGGGGTCGGGGGAGGG + Intergenic
917544501 1:175949284-175949306 CCATATTCGGGGTGGGGGGCTGG + Intronic
920343871 1:205293336-205293358 CTTTATAAGGGGCTGGGGCCAGG + Intergenic
920653486 1:207856192-207856214 CCTTAAATGGGGTTGGGAGCTGG - Intergenic
923510303 1:234645875-234645897 ACTTATAAGGGGTCTAAGGCAGG - Intergenic
924160268 1:241224244-241224266 CCTGTTGAGGGGTGGGGGGCTGG - Intronic
924282545 1:242452808-242452830 CCACATCAGGGGTGGGGGGCAGG - Intronic
924333933 1:242967952-242967974 CCTTAGCAGGGGTAGGGGGACGG - Intergenic
1066714006 10:38266827-38266849 CCTGTCAAGGGGTTGGGGGCTGG + Intergenic
1068764010 10:60742963-60742985 GCTTTTCTGGGGTCGGGGGCAGG - Intergenic
1071001308 10:80833430-80833452 CCTGTTGAGGGGTGGGGGGCAGG + Intergenic
1071364065 10:84880997-84881019 CCTGTTAAGGGGTTGGGGGCTGG - Intergenic
1073047629 10:100649969-100649991 CCTACTGAGGGGTGGGGGGCAGG + Intergenic
1074858376 10:117490473-117490495 CATTCTAATGGGTCAGGGGCTGG - Intergenic
1081403316 11:42667609-42667631 CCTTAGAAGGGGTAGGAGGGAGG + Intergenic
1082716563 11:56620849-56620871 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1083732881 11:64662484-64662506 GTTTAAAAGGGGTCGGGGCCGGG + Intronic
1083823347 11:65184495-65184517 CCATCTGAGGGGTCGGGGCCAGG - Intronic
1084542775 11:69797752-69797774 CCGTATGAGGGGTGTGGGGCTGG + Intergenic
1084946606 11:72642166-72642188 CCTGAGAAGGGTTCGGGGGCGGG + Intronic
1087565373 11:99849487-99849509 CCTGACAAGGGGTTGGGAGCAGG - Intronic
1087698326 11:101406939-101406961 GCTTAAAAGGGGAGGGGGGCTGG + Intergenic
1089563085 11:119355669-119355691 TCTGAGAAGGGGGCGGGGGCAGG + Exonic
1089934790 11:122352885-122352907 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1090120165 11:124018349-124018371 CCTTTTGGGGGGTGGGGGGCTGG - Intergenic
1092768499 12:11874889-11874911 CCTGTTATGGGGTCGGGGGAGGG + Intronic
1093678170 12:21968197-21968219 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1097804009 12:63945413-63945435 CCTGTTGAGGGGTAGGGGGCTGG - Intronic
1098136610 12:67409513-67409535 CCTGTTGAGGGGTGGGGGGCTGG + Intergenic
1099467693 12:83006931-83006953 CCTGTCATGGGGTCGGGGGCTGG + Intronic
1100493123 12:95100059-95100081 ACTTATATGGGGTGGGGGGGGGG - Intronic
1101933723 12:109038161-109038183 CCTTTGGAGGGGTCGGGGGAGGG - Intronic
1103420862 12:120781000-120781022 CTATATAAGGGGTCTGTGGCTGG + Intronic
1108412793 13:50166943-50166965 CCTGTTAGGGGGTGGGGGGCTGG + Intronic
1109225710 13:59692415-59692437 CCTTATTTGGTGTCGGGGGATGG - Intronic
1110815696 13:79857960-79857982 CCTGTCAGGGGGTCGGGGGCCGG + Intergenic
1116698328 14:48203792-48203814 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1119790307 14:77344065-77344087 CCTTATAAAGGGTTTGGAGCAGG - Intronic
1120637498 14:86970073-86970095 CCTGTTATGGGGTCGGGGGAGGG + Intergenic
1125093807 15:35828021-35828043 CCTTATAAAAGGTTGGGGGTTGG - Intergenic
1128744115 15:70101755-70101777 CCAAATAAGGGGCTGGGGGCTGG - Intergenic
1129742109 15:77994290-77994312 CCTTCCAAGGGGTGGGGAGCAGG + Intronic
1129843374 15:78757179-78757201 CCTTCCAAGGGGTGGGGAGCAGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130674999 15:85943763-85943785 GCTTATAAGGTTTTGGGGGCTGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1137716914 16:50603744-50603766 CCTTATAAGGCCTCCGGGGATGG - Intronic
1140775744 16:78247615-78247637 TTTTATAAGGGGCAGGGGGCAGG - Intronic
1141741912 16:85899118-85899140 CCTTAAAAAGGGTCGTGGGGGGG - Exonic
1145733178 17:27209058-27209080 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
1149506521 17:57198487-57198509 CCTAACAATGGGTAGGGGGCGGG - Intergenic
1150648847 17:66996920-66996942 GTTTATAAGGGGACGAGGGCAGG + Intronic
1150995448 17:70312146-70312168 CCTGTTGGGGGGTCGGGGGCTGG - Intergenic
1151502659 17:74501548-74501570 CCTGTCAAGGGGTGGGGGGCTGG - Intergenic
1151556015 17:74847152-74847174 GCTGAGAAGGGGTTGGGGGCTGG - Intronic
1153075552 18:1157897-1157919 CCTGTTGAGGGGTGGGGGGCTGG - Intergenic
1159219159 18:65437510-65437532 CCTGTTGAGGGGTCGGGGGACGG + Intergenic
1159663247 18:71125423-71125445 CCTATTAGGGGGTGGGGGGCTGG + Intergenic
1165829441 19:38723266-38723288 CCTGAGGAGGGGTAGGGGGCAGG - Intronic
1165926172 19:39327532-39327554 CCTGAAAAGGGGTGGGGGGAGGG + Intergenic
924982062 2:232590-232612 CCTTTCAGGGGGTTGGGGGCTGG - Intronic
926332137 2:11834422-11834444 CCTAATATGGGGGCGGGGGCTGG - Intergenic
928755605 2:34521881-34521903 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
932475326 2:72002444-72002466 CCTTATCAGGGGTGGGGAGCGGG - Intergenic
933934324 2:87188742-87188764 AATTATAAAGGGTCGGGGGGTGG - Intergenic
934992432 2:98930969-98930991 CCTTAGATGGGGTGGGGGGGTGG - Intronic
936358819 2:111777153-111777175 AATTATAAAGGGTCGGGGGGTGG + Intronic
938309052 2:130274296-130274318 CCTGCTAAGGGGTGGGGGGGTGG - Intergenic
939139749 2:138340126-138340148 TTTTTTAAGGGGTGGGGGGCAGG - Intergenic
939526806 2:143305316-143305338 CCTGTCAGGGGGTCGGGGGCTGG + Intronic
940720209 2:157273972-157273994 CCTTTTAGGGGGTGGGGGGCTGG - Intronic
940989982 2:160086981-160087003 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
940996367 2:160154426-160154448 CCTGTTATGGGGTGGGGGGCTGG + Intronic
942538846 2:176994515-176994537 CCTGTTGAGGGGTGGGGGGCTGG + Intergenic
942875173 2:180786492-180786514 CCTTTTGTGGGGTGGGGGGCAGG + Intergenic
1169153867 20:3312655-3312677 CCTTAGAAGGGGACTTGGGCAGG - Intronic
1170962584 20:21038423-21038445 CCTGTTGAGGGGTTGGGGGCTGG + Intergenic
1171959543 20:31484140-31484162 CCCTCTAAGGGGGCGGGGCCCGG - Exonic
1173652612 20:44676516-44676538 CCTTCTTAAGGGTCGGGGGGGGG - Intergenic
1173666474 20:44766771-44766793 CATAATAAGGGGTGGGGGGATGG - Intronic
1173961816 20:47079486-47079508 CCTTATAAGGGGTCGGGGGCAGG - Intronic
1176422151 21:6524949-6524971 CCTCATCAGGGGTCTGAGGCAGG - Intergenic
1179095858 21:38313964-38313986 CCTGATATGGGATGGGGGGCAGG + Intergenic
1179697641 21:43133264-43133286 CCTCATCAGGGGTCTGAGGCAGG - Intergenic
1180539618 22:16431725-16431747 CCTATCAAGGGGGCGGGGGCAGG + Intergenic
1183563541 22:38595963-38595985 ACTAATAAGGGGGGGGGGGCAGG + Intronic
1183756909 22:39775901-39775923 CTTTTTAAGGGGTTGGGGGCAGG + Intronic
1183830810 22:40417550-40417572 CCTTGTAGGGGGCGGGGGGCGGG + Intronic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1184110016 22:42389031-42389053 ACTTAGAAGGGGTCTGGGCCTGG - Intronic
1184985141 22:48127196-48127218 CCTTTTGGGGGGTGGGGGGCAGG - Intergenic
949120867 3:382031-382053 CCATATGTGGGGTGGGGGGCGGG + Intronic
950690615 3:14652896-14652918 CCGTCTAAGGGGCGGGGGGCGGG + Intronic
951012937 3:17701319-17701341 CCTGTTAGGGGGTAGGGGGCTGG + Intronic
951204184 3:19909031-19909053 CCTTGTAGGGGGTGGGGGGCGGG - Intronic
953652133 3:44816390-44816412 CCTGTCAAGGGGTGGGGGGCTGG - Intronic
957402883 3:79739426-79739448 CCTTATAAGTGGTCTGGGTTTGG + Intronic
961096626 3:124162134-124162156 CCTAAGAGGGGGTTGGGGGCAGG + Intronic
961939743 3:130624729-130624751 CTTGGTCAGGGGTCGGGGGCAGG + Intronic
963868290 3:150386067-150386089 CCTTATATGGGGCTGGGGGGAGG + Intergenic
968728989 4:2261067-2261089 CCTTTTAAGGGGGCGGGAGGAGG - Intronic
969084049 4:4642037-4642059 CCTTTGAAGGGGGCTGGGGCTGG - Intergenic
970456050 4:16225996-16226018 CCCTAGAAGGGGTCTGCGGCCGG - Intronic
970884237 4:20968770-20968792 CCTGTCAAGGGGTGGGGGGCTGG + Intronic
972885927 4:43487793-43487815 CCTTTTAGGGGGTACGGGGCTGG - Intergenic
974114082 4:57559430-57559452 CCTGTCAGGGGGTCGGGGGCTGG - Intergenic
975756342 4:77575444-77575466 CCTGTTGAGGGGTAGGGGGCTGG - Intronic
980329879 4:131397800-131397822 GCTTATCAGGGGTTGGGGGATGG - Intergenic
981200216 4:141971688-141971710 CCTGTTTGGGGGTCGGGGGCTGG + Intergenic
984372937 4:178889921-178889943 CCTTTCATGGGGTAGGGGGCTGG + Intergenic
985791191 5:1927848-1927870 CCTTAAGCGGGGCCGGGGGCAGG + Intergenic
987553072 5:19409140-19409162 GCCTGTCAGGGGTCGGGGGCAGG + Intergenic
988060057 5:26154789-26154811 GATTACAAGGGGTCGGGGGTGGG + Intergenic
988469843 5:31527640-31527662 CCTGGTAAGGGGTGGGTGGCAGG - Intronic
989223045 5:38990334-38990356 GCCTATCAGGGGTCGGGGGAGGG + Intronic
992342657 5:75841366-75841388 CCTGTTATGGGGTCGGGGGAGGG - Intergenic
993489732 5:88532304-88532326 CCTGTCAAGGGGTAGGGGGCTGG + Intergenic
996914749 5:128698922-128698944 CTTTATAGGAGGTGGGGGGCAGG - Intronic
998399612 5:141841709-141841731 CCTTCCAAGGGGTGGGGGCCGGG + Intergenic
999425234 5:151482289-151482311 CCTTATGAGGGTTCCTGGGCGGG - Intronic
1001597766 5:172908946-172908968 TCTTATAAGGGATCAGGGCCTGG - Intronic
1007501867 6:42304678-42304700 ACTTCTAAGGGGTAGGGGCCAGG - Intronic
1009184075 6:60552868-60552890 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1010501096 6:76601336-76601358 CCTGCTGAGGGGTAGGGGGCTGG + Intergenic
1011242817 6:85290060-85290082 CCTGTTGAGGGGTCGGTGGCTGG + Intergenic
1011402853 6:86982522-86982544 CCTGAAGAGGGGTCTGGGGCAGG + Intronic
1011433050 6:87308219-87308241 CCTGACATGGGGTCGGGGGAGGG + Intronic
1012445747 6:99305437-99305459 ACTAATAAGGGGTGGGGGTCAGG - Intronic
1012549806 6:100456046-100456068 CCTTAAAAGGTGGCGGGGGTGGG - Intronic
1014461281 6:121698742-121698764 CCTTATAAGTGAGCTGGGGCAGG - Intergenic
1017601007 6:156081194-156081216 CCTGTTATGGGGTCGGGGGAGGG + Intergenic
1020694807 7:11400154-11400176 CCTGTTATGGGGTCGGGGGAGGG + Intronic
1025843525 7:65174561-65174583 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025879520 7:65521406-65521428 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1025893918 7:65681182-65681204 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1026800693 7:73397985-73398007 CCTTGTTGGGGGTGGGGGGCGGG + Intergenic
1032846613 7:135756881-135756903 CATTAAAATGGGTTGGGGGCAGG - Intergenic
1034540498 7:151755091-151755113 CCTGAGCGGGGGTCGGGGGCTGG + Intronic
1036203835 8:6791146-6791168 CCTTAAAAGCGGTGGGGGGGGGG + Intergenic
1037834536 8:22208388-22208410 CCTAGTATGGGGTGGGGGGCAGG - Intronic
1038200746 8:25410465-25410487 CTTTTTAGGGGGGCGGGGGCAGG + Intronic
1038428532 8:27481300-27481322 CCTCATAAAGGCTCGGGGCCAGG - Intergenic
1042596997 8:70460375-70460397 CCTGTTGTGGGGTCGGGGGCTGG - Intergenic
1043821234 8:84867903-84867925 ACTTATATCTGGTCGGGGGCAGG + Intronic
1044291992 8:90483110-90483132 CCTTTTAGGGGATGGGGGGCTGG - Intergenic
1050597845 9:7221968-7221990 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1050854990 9:10343125-10343147 CCTGTCAGGGGGTCGGGGGCTGG - Intronic
1056190316 9:84178290-84178312 CCTGTTGAGGGGTGGGGGGCTGG - Intergenic
1056190959 9:84183306-84183328 CCTGTTGAGGGGTGGGGGGCTGG + Intergenic
1056320569 9:85431021-85431043 TCTGATAAGGGGTGGGGGGATGG + Intergenic
1061651106 9:132050735-132050757 CCTTTGATGGGGTTGGGGGCAGG - Intronic
1062107616 9:134764309-134764331 CATTATAGGGGGTCAGGGGGCGG + Intronic
1188354804 X:29177742-29177764 CCTGTCATGGGGTCGGGGGCTGG - Intronic
1191807491 X:65150486-65150508 CCTGTTGGGGGGTCGGGGGCAGG - Intergenic
1192678082 X:73221371-73221393 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1195405844 X:104512413-104512435 CCTGGTGAAGGGTCGGGGGCAGG - Intergenic
1196011399 X:110891708-110891730 CCTGTTGGGGGGTCGGGGGCTGG + Intergenic
1196099539 X:111833070-111833092 CTCTATAAGGGGGCAGGGGCAGG - Intronic
1196650438 X:118163379-118163401 CCAGATATGGGGTCGGGGGTGGG - Intergenic
1198276779 X:135102056-135102078 CCTTACAAGGGGATGGGGGAGGG - Intergenic
1199640436 X:149856108-149856130 CCTGTTCGGGGGTCGGGGGCTGG - Intergenic
1199645525 X:149906578-149906600 CCTTTTGGGGGGTAGGGGGCTGG + Intergenic
1202058834 Y:20864786-20864808 CCTCATGTGGGGTTGGGGGCAGG - Intergenic
1202390892 Y:24369440-24369462 CCTTAGCAGGGGTAGGGGGACGG + Intergenic
1202479892 Y:25300676-25300698 CCTTAGCAGGGGTAGGGGGACGG - Intergenic