ID: 1173965452

View in Genome Browser
Species Human (GRCh38)
Location 20:47109138-47109160
Sequence CTTCAGGGGGAGACCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 118, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173965452_1173965459 4 Left 1173965452 20:47109138-47109160 CCATCCAGGGTCTCCCCCTGAAG 0: 1
1: 0
2: 3
3: 118
4: 233
Right 1173965459 20:47109165-47109187 CTGATTGCTTCTACCCCTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173965452 Original CRISPR CTTCAGGGGGAGACCCTGGA TGG (reversed) Intronic
900119268 1:1041649-1041671 CTGCAGGAGGAGACCCCGGGCGG - Exonic
900141803 1:1141821-1141843 CGACCGGGGGAGACCCTGCATGG + Intergenic
900400952 1:2472663-2472685 CTTCAGAGGGAGACACGGGTGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903276224 1:22223610-22223632 TTTCAGTTGGAAACCCTGGAGGG + Intergenic
903370465 1:22831948-22831970 CTGCAAAGGGAGCCCCTGGAGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905550071 1:38830476-38830498 CTGAAGGGGGACACCCTGCAAGG - Intergenic
905922823 1:41730525-41730547 ATGCTGGGGGAGACCCTGGAGGG + Intronic
906137087 1:43507211-43507233 CTTCAGAAGCAAACCCTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907586261 1:55620650-55620672 CTGCAGGGGCAGAGCCTTGATGG + Intergenic
908237496 1:62160959-62160981 GTTAATGGCGAGACCCTGGAAGG + Exonic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
921947009 1:220892987-220893009 TTTCAGCTGGAGACCCTTGACGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923049421 1:230380433-230380455 CTTTAGGGTGAGCACCTGGAAGG - Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062925746 10:1314413-1314435 CTGCAGGGGCAGACCAGGGAGGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063114395 10:3063835-3063857 CTTCAGCCTGAGACCCTGGGAGG + Intergenic
1063346066 10:5313533-5313555 CTGCCGGGGGAGTCCCTGAAGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065084425 10:22160666-22160688 CTTCACTGTGAGAACCTGGAAGG - Intergenic
1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG + Intergenic
1067214099 10:44286126-44286148 TTTCAGAGAGAAACCCTGGAGGG - Intergenic
1067428492 10:46226884-46226906 CTTCATGGCAAGACCCTGGTGGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069382237 10:67852793-67852815 CTTCAGGGGGAGGGACTAGATGG + Intergenic
1071677899 10:87673628-87673650 CTTGAGGGGGAAAACCTGGATGG - Intronic
1072449905 10:95531660-95531682 CTTCGGGGGTGGACCCGGGACGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073048387 10:100653324-100653346 TCACAGGGGGAGACGCTGGATGG + Intergenic
1073081294 10:100862637-100862659 TTACAGGGTGAGGCCCTGGAGGG + Intergenic
1074349722 10:112724469-112724491 CTTCCAGGGTAGATCCTGGAAGG + Intronic
1074943227 10:118255080-118255102 CTTGAGGGGAGGACCCTGGAAGG - Intergenic
1075428666 10:122362796-122362818 CCACAGGGGGAGGCCCTTGATGG + Intergenic
1076674512 10:132141186-132141208 CTCCCGTGGCAGACCCTGGAGGG + Intronic
1076764827 10:132627328-132627350 CTTCACGGGGAGACCGGGGCCGG + Intronic
1077014654 11:394205-394227 CTTCAGGGAGAGGGCCTCGAGGG + Exonic
1077124305 11:925689-925711 CTGCAGGCGGACACCATGGACGG - Intronic
1077372960 11:2192290-2192312 CTGGAGGGGGTGACCCAGGAGGG - Intergenic
1077473809 11:2777095-2777117 CATCATGGGGAGAGCCAGGAGGG - Intronic
1078106752 11:8362733-8362755 CTTCAGGGAGAGGCCGTGCAGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080652074 11:34230671-34230693 CTTCAGGCAGACACCATGGAAGG - Intronic
1081531991 11:43968225-43968247 CTTTAGGGTGAGACCCTTTAGGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083631295 11:64096854-64096876 CTGCCGGGGGAGGCCCTCGAAGG - Intronic
1083904018 11:65658540-65658562 GTTGAGGGGGAGACCATGGAGGG - Intronic
1084481154 11:69420920-69420942 CTGCTGGGGGAGCCCCTGGATGG + Intergenic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085520501 11:77136419-77136441 CCCCTGGGGGAGACCCTGCAAGG - Intronic
1086892203 11:92271170-92271192 CTTCATGGGAAGCCCCTGGAAGG - Intergenic
1087472940 11:98600717-98600739 CTTCAGGGAGAGACTCAGGATGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090105902 11:123853569-123853591 CTTCAGGTGGAGCCCTTGCACGG + Intergenic
1090490267 11:127154574-127154596 ATTCAGGGGCAGACTGTGGAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091820202 12:3470520-3470542 CTTCACAGTGAGGCCCTGGAGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094410666 12:30165142-30165164 CTGCAGGGAGAGGGCCTGGAGGG - Intergenic
1095639247 12:44468034-44468056 CTTCAGGGGCAGAACCTTCATGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096600404 12:52724715-52724737 CTTCAAGGGGAGCACATGGATGG + Intergenic
1098091864 12:66911077-66911099 CTCCAGGGAGAGCCCCTTGAGGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1103477239 12:121227650-121227672 CTTGAGGGGAAGAACCTGGAAGG + Intronic
1105577180 13:21664745-21664767 CTTCACAGGGAGAACCTGGTAGG + Intergenic
1105752120 13:23430922-23430944 CTTGAGGGGGATACCATGGTAGG + Intronic
1107724809 13:43287915-43287937 CTTCAGTGTGAGACTCTTGAAGG - Intronic
1108844760 13:54663896-54663918 CATCAGGGTGACACGCTGGAAGG + Intergenic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1110969204 13:81739769-81739791 CTTCTGTGGGAGACCAGGGAAGG - Intergenic
1111241647 13:85482404-85482426 CTTCAGGGGCAGAGCCTTCATGG - Intergenic
1111334570 13:86803112-86803134 CTGCAGGGGCAGAGCCTGCATGG - Intergenic
1112049551 13:95632211-95632233 CTTAAGGTGGAGACCCAGGCTGG - Intronic
1112884365 13:104150572-104150594 CTTCAGTGTGAGAACCTGGTAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114226739 14:20745581-20745603 CTTCTGGGGAAGTCCCTGGAGGG - Intronic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1119802015 14:77454131-77454153 CTTTAGGGAGAGACCCAGAAAGG - Intronic
1122042835 14:99001417-99001439 GTTCTGGGGGAGACCCTGATTGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122788849 14:104176059-104176081 CCTGAGGGGGGGCCCCTGGAGGG + Exonic
1122935495 14:104954174-104954196 CTCCATGGAAAGACCCTGGAGGG - Exonic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126847073 15:52770163-52770185 CTGCAGTGGGAGAGACTGGAAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128300708 15:66564840-66564862 CTGCAGGGGGAGACCCGTGCTGG + Intronic
1128309231 15:66620191-66620213 TTCCAGGGGGAGACCTTGGTTGG - Intronic
1128850942 15:70955059-70955081 CTGCAGGGGGAAACCATGGGTGG + Intronic
1129196392 15:73969747-73969769 GTTCAGTGGGAGCCCCTGCAGGG - Intergenic
1129385902 15:75195994-75196016 CTCCAGGGAGAGGCCCTGGATGG + Intronic
1129791117 15:78341186-78341208 TTTGAGGAGGAGACCGTGGACGG + Exonic
1132470577 16:100618-100640 CTGCAGGTGGAGACCCGGGCAGG + Intronic
1132514719 16:360905-360927 CTTCAGGGACAGGCCCTGCAAGG - Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133467405 16:6041110-6041132 CTGCAGGGGGAGAGCAGGGAGGG - Intronic
1135181935 16:20282502-20282524 GGTCAGGGGAAGACCCTGAAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137612332 16:49826975-49826997 CTTCAGGGGGACATTCCGGAGGG + Exonic
1137705897 16:50535668-50535690 CCTCAGGGGGTCACCTTGGAGGG + Intergenic
1138503802 16:57466086-57466108 CTTCTGGGGGTGAGGCTGGAAGG - Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139589969 16:67928125-67928147 CTCCAGTGGGAGACCCTGGTAGG + Exonic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139884092 16:70196662-70196684 CTTCTGGGTGAGAGCCAGGAAGG + Intergenic
1140368426 16:74398834-74398856 CTTCTGGGTGAGAGCCAGGAAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142867564 17:2799965-2799987 CTCCTGGGGCAGACCCTGGTGGG - Intronic
1143164542 17:4891433-4891455 CTGCAGGGAGAGACCAGGGAGGG - Intronic
1143240273 17:5438047-5438069 CTTCTGGGGATGACCCAGGATGG + Intronic
1143419828 17:6780054-6780076 CTTCAGCGGGAGACCTTCCAGGG + Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146462436 17:33056821-33056843 CTTCAGAAGGAAACCCTGGGTGG - Intronic
1146645245 17:34572897-34572919 CATAAAGGGGAGACCCAGGAAGG - Intergenic
1147196626 17:38770853-38770875 GTTCAGGTGGTGACCCTGGATGG + Intronic
1149368889 17:55973210-55973232 GTTAAAGGGGAGACCCTGGCCGG + Intergenic
1150122669 17:62616998-62617020 CTTTATGGGGAGCACCTGGAGGG + Intergenic
1150229857 17:63544004-63544026 GCTCATGGGGAGACCCTGGCAGG - Exonic
1150621973 17:66814498-66814520 CTTCAGGGCCAGACCCTGTTGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152130619 17:78474105-78474127 CTGCAGGCAGAGACCCTGGAGGG - Intronic
1152331733 17:79677559-79677581 CTTCAGTGGGACGCCCTAGAAGG + Intergenic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153560127 18:6363278-6363300 CATCAGGGGCTGCCCCTGGACGG - Intronic
1157109633 18:44808475-44808497 CTTCAGGGGGAGACCTGAGGTGG + Intronic
1157452772 18:47800809-47800831 CTTCTGTGGGAGGGCCTGGAGGG - Intergenic
1160368794 18:78353081-78353103 CTTGGGGCGGAGACCCTAGAAGG + Intergenic
1161154737 19:2726776-2726798 CCACAGGGAGAGACCCTGGAGGG + Intronic
1161681510 19:5681974-5681996 CTTCATGGGCTGTCCCTGGAAGG + Intronic
1162471052 19:10872052-10872074 CTGCAGGGAGCGACCGTGGAGGG + Intronic
1162554975 19:11381193-11381215 CCCCAGGTGGAGATCCTGGAGGG - Exonic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164725885 19:30465342-30465364 CTTCAGGGGGTGACTGGGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166808609 19:45501683-45501705 CCTTAGGAGGAGACCCTGAAAGG - Intronic
1167144465 19:47673475-47673497 CTTCAGGGGAGCCCCCTGGAGGG - Intronic
1167349982 19:48968495-48968517 CTGCAGGCGGATTCCCTGGAGGG + Exonic
1167493600 19:49805672-49805694 CTTCAGGGTGAGGGCCTGGGGGG - Exonic
1167586209 19:50377135-50377157 CTTTAGGGGCTGAACCTGGAAGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168489322 19:56795215-56795237 CTGCAGGGAGGGACCCAGGACGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925449196 2:3953713-3953735 GTTCAGGGTGAAACTCTGGATGG - Intergenic
926095951 2:10080534-10080556 CTGTAGGGGGAGACCCGGGAGGG - Intronic
926159220 2:10475987-10476009 CTTCAGGGAGGGGCCCTGGGAGG - Intergenic
926427767 2:12754900-12754922 CTCCTGGGGCTGACCCTGGAAGG + Intergenic
926679400 2:15652465-15652487 CTGCAGGGAGAGACCATGGCGGG - Intergenic
927101152 2:19788782-19788804 TGTCAAGGGGAGACCTTGGAGGG - Intergenic
927213410 2:20652268-20652290 GTTCTGAGGGAGACCCTTGAAGG + Intergenic
927436424 2:23070460-23070482 CGTGAGGGGGTGACCCTGGCTGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928296048 2:30085057-30085079 CTCAAGGGGGATACCCTTGAAGG - Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928611004 2:32992767-32992789 CCTCAGGAGGAGATCCTGCAGGG + Intronic
929095587 2:38260641-38260663 CCACAGGGGGAAACCCAGGATGG - Intergenic
929192443 2:39151924-39151946 TTTCAGGAGGAGAACATGGATGG - Intergenic
929583190 2:43097425-43097447 CTTCAGCTGGGGACCCGGGAAGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931632580 2:64314701-64314723 GCTCATGGGAAGACCCTGGATGG + Intergenic
933328028 2:80863466-80863488 CCCCAGGGGCAGACACTGGAGGG - Intergenic
935230915 2:101095113-101095135 CTTCACGGTGAGAACCTGGCGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935827708 2:106968254-106968276 ACTCAGGGTGAGCCCCTGGATGG + Intergenic
938088319 2:128416411-128416433 CTTGATGGGGGGGCCCTGGAGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938560205 2:132465516-132465538 TTTCCTGGGGAGTCCCTGGATGG + Intronic
939667114 2:144965616-144965638 CTTTAGGGGCAGACCCTTCATGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941719503 2:168798505-168798527 CTTCCAGGCCAGACCCTGGAAGG + Intronic
941858610 2:170254937-170254959 CTCCTGGGGCAGACACTGGAGGG + Intronic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944316531 2:198291099-198291121 CTACAGGGAGAGACCGAGGAGGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947565377 2:231190053-231190075 CCTCCAGGGAAGACCCTGGAAGG + Intergenic
947603252 2:231467677-231467699 CTTCAGTGGAAGAGCCTGGAAGG - Intronic
947960199 2:234229960-234229982 CTTCAGGAGAAGGCCCTGGTTGG - Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948930042 2:241126240-241126262 CTGCAGCGGGAGATCCAGGAGGG - Exonic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169141542 20:3229818-3229840 TGGCAGGGGGAGGCCCTGGAGGG + Intronic
1169206856 20:3745485-3745507 CTTCAAGGTGAGATCCTGGCAGG - Exonic
1170717477 20:18844454-18844476 CTTAATGGAGAGAACCTGGAAGG + Intergenic
1172444137 20:34984461-34984483 CTGCAGGTGGAGACTCTGGCTGG + Intronic
1172883876 20:38218568-38218590 CTTCAAAGCGGGACCCTGGAGGG + Intronic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174081549 20:47973711-47973733 ATTCAGGAGGTGACCCTCGAAGG + Intergenic
1174134953 20:48373175-48373197 ATTCAGGAGGTGACCCTCGAAGG - Intergenic
1176021611 20:62965109-62965131 CTACAGGGGGAGGCCAAGGAAGG - Intronic
1177120653 21:17133122-17133144 CCTCAAGGGGGGACCCTGGCAGG - Intergenic
1180023353 21:45143381-45143403 CTTCAGCCTGAGAGCCTGGAAGG - Intronic
1181574296 22:23783916-23783938 CTTCAGTGCCAGCCCCTGGAAGG - Exonic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181814770 22:25429785-25429807 CATGAAGGAGAGACCCTGGAAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183922066 22:41177462-41177484 CTGCAGGTGGGGGCCCTGGAAGG - Exonic
1184115480 22:42419343-42419365 CTGCTGGAGGAGACCCAGGAAGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
950740687 3:15049462-15049484 CTTTAGTGGGAAACCCTGGCAGG + Exonic
950900188 3:16490524-16490546 CTTTAGGGGGTTCCCCTGGATGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954973474 3:54671584-54671606 CTGCTGGGGGAAACACTGGAAGG - Intronic
955516628 3:59732386-59732408 CTTCTGTGGGTGAACCTGGATGG + Intergenic
957445243 3:80308029-80308051 CTGCAGGGGGAGCCTCTGGCAGG - Intergenic
957916764 3:86695940-86695962 CTGCAGGGGGAGCCTCTGGTGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961455888 3:127023749-127023771 CTGCCGGGAGAGACACTGGACGG + Intronic
962321822 3:134396760-134396782 CTTCTGTGTGAGACCCTGGCTGG + Intergenic
963035128 3:141019399-141019421 GTTCAGAGGGAGGCCCTGGGCGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965233970 3:166091121-166091143 CTTCAGGGGCAGACCCCTCAAGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967893999 3:194382542-194382564 ATTCAGGGAGAGATCCTGGAAGG - Intergenic
968376717 4:50078-50100 CTGCAGGAGGAGAGCCTGCAGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970923874 4:21427523-21427545 CTTCTAGGGGATACCCTGCAGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973046604 4:45541591-45541613 CTTCAGGGGCAGAGCCCTGAGGG + Intergenic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976750051 4:88444460-88444482 CTGAAGGGGAAGACCCTAGATGG + Intergenic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
977492351 4:97731547-97731569 CTTCTGGGGCAGACACCGGAAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979222449 4:118244064-118244086 CTGCAGGGTGAGAGCCTGGGTGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984722972 4:182993475-182993497 CTTCCAGGGGAGGCCTTGGATGG + Intergenic
984768000 4:183414171-183414193 GTTCAGGGGGAGGCCTGGGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
986482329 5:8202171-8202193 CTTCAGGGGGAGCTCCGGGAAGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991405159 5:66294159-66294181 CTTGAGCGGGAGCCCGTGGAAGG - Intergenic
993604838 5:89976469-89976491 CTTCAGGGAGAGACTTTGGTGGG - Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001603614 5:172944847-172944869 CTGGAGGGGGAGACCCTGGATGG - Intronic
1001922129 5:175609117-175609139 CTTCAGGGTGAGGCCCAGAATGG - Intergenic
1002089977 5:176798655-176798677 CTTCAGGGTGGGATCTTGGAGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003442698 6:6158591-6158613 CTTCATGGGGAGGCCGGGGATGG - Intronic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1005710548 6:28500106-28500128 CTTCAGGGACAGCCACTGGAAGG + Intergenic
1006060695 6:31416448-31416470 CTTCAGGGGCTGACCCTGTGGGG + Intergenic
1006679544 6:35787267-35787289 CTTCTGGGGGAGCCTGTGGACGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1011437957 6:87358815-87358837 CTTCAGGCAAAGACCCTGGAGGG + Intronic
1011736388 6:90314541-90314563 CCTCAGTGTGAGACCCTGTAGGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1017011741 6:150068171-150068193 CTTCAGGGAGGGTCCCTGAATGG + Intronic
1019012237 6:168851169-168851191 CTTCATCTGGAGACCCTGAAGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019779260 7:2929937-2929959 CTGCAGGGGGAGACAATGGAGGG + Intronic
1019793406 7:3032318-3032340 GTTCAAGAGGAGACCCTGGGCGG + Intronic
1019987449 7:4668134-4668156 CTTGAGGGGCAGACTCTGGAAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022478779 7:30729373-30729395 GTTCAGGGGGACGCCATGGAGGG + Intronic
1024223908 7:47310378-47310400 TTTCAAGGTGAGACCCTTGAAGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026892850 7:73992491-73992513 TTGCAGGGGAAGTCCCTGGAAGG + Intergenic
1027232893 7:76282454-76282476 GTTCAGGGGGAGCCCCGTGAGGG - Intronic
1029893746 7:103959518-103959540 CTTCAGTGGGAGAATCTGCAGGG - Intronic
1030824279 7:114135851-114135873 CTTCAGGGTGAGAACTAGGAAGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035001263 7:155614128-155614150 CATCATGGGGAGGCGCTGGATGG - Intronic
1035768067 8:2124326-2124348 GTTCTGTGGGAGGCCCTGGATGG + Intronic
1037648433 8:20815140-20815162 TTCCAGTGGGAGACTCTGGAGGG - Intergenic
1037751595 8:21685919-21685941 CTCCAGGGAGAGCCCCAGGAGGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038615508 8:29090233-29090255 TTTCAGTGGGAGACACTGGAAGG + Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039386192 8:37137831-37137853 GCTCAGGGGGAGTCTCTGGATGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040959214 8:53013221-53013243 CCTCAGGGGTACACCCTTGAAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045424940 8:102056532-102056554 CTCCATGGAGAGACTCTGGATGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047029790 8:120863678-120863700 ATTCAGGGGGAAACACTAGAGGG + Intergenic
1048077208 8:131084543-131084565 CTTCAGGCTGACTCCCTGGATGG - Intergenic
1048548959 8:135415896-135415918 ATTCAGGAGGAGACCATGGGTGG - Intergenic
1049040805 8:140110747-140110769 CTTCAGGGGGAGCTACTGTAGGG - Intronic
1049173915 8:141179864-141179886 CTTAAGGGGCAGGCCCTGGACGG + Intronic
1049613537 8:143566881-143566903 CATGAGGTGGAGACCCAGGAGGG + Exonic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051269988 9:15346141-15346163 CCCCAGTGGGAGACCCTAGAAGG - Intergenic
1051335701 9:16064139-16064161 TTTCAGAGTGAGACCCTGCATGG + Intergenic
1051359767 9:16271601-16271623 CGTGAGGAAGAGACCCTGGATGG + Intronic
1053424753 9:38003620-38003642 CTTCAGGGTGAAGCTCTGGAGGG - Intronic
1055080080 9:72260057-72260079 CTTCAGGAGGAAATCATGGATGG + Intergenic
1055692275 9:78845780-78845802 CTTCAGGGTGAGTCCCAGGATGG - Intergenic
1059734382 9:117086837-117086859 CTTCAGTGGGAATCCCTGCAGGG + Intronic
1060130554 9:121093802-121093824 CTTGAGGGGAAGATCCAGGAGGG + Intronic
1060212313 9:121718058-121718080 CTTGGTGGGGAGGCCCTGGATGG + Intronic
1061296062 9:129677459-129677481 CCTCTGGGGGAGGCCCAGGAGGG + Intronic
1061379365 9:130244821-130244843 CTTCTGGGAGAGCCCCTGGCAGG - Intergenic
1062565447 9:137162116-137162138 CGGCGGGGGGAGTCCCTGGAGGG + Intronic
1062642130 9:137524413-137524435 CTTCACGAGGAGACACTGCAAGG - Intronic
1203548804 Un_KI270743v1:151842-151864 CTTCAGCGGGAGTCCGTTGAAGG - Intergenic
1203572513 Un_KI270744v1:144168-144190 CTGCAGGAGGAGAGCCTGCAGGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190064339 X:47229824-47229846 CTCCAGGGTCAGTCCCTGGATGG + Exonic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1194178854 X:90688468-90688490 CTGCAGGGGAAGACCCTTTATGG - Intergenic
1194602104 X:95934809-95934831 TTTCACGGGGAGACACTGGGGGG - Intergenic
1195577693 X:106468806-106468828 CCACAGGGGCAGAGCCTGGATGG + Intergenic
1195968527 X:110450775-110450797 CTTCAGCCTCAGACCCTGGAGGG + Exonic
1200077352 X:153557712-153557734 CTGCATGGGGACACCCTGGGCGG - Intronic
1200243115 X:154508046-154508068 CTTCATGGAGAGCCCCCGGAGGG - Intronic
1200525518 Y:4270638-4270660 CTGCAGGGGAAGACCCTTTATGG - Intergenic
1201640541 Y:16172057-16172079 CTGCAGGGGTAGACTCTGGTGGG + Intergenic
1201662274 Y:16413269-16413291 CTGCAGGGGTAGACTCTGGTGGG - Intergenic