ID: 1173966319

View in Genome Browser
Species Human (GRCh38)
Location 20:47115424-47115446
Sequence TGAGCCTCCCAGTGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173966319_1173966320 19 Left 1173966319 20:47115424-47115446 CCTGTTATTCACTGGGAGGCTCA 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1173966320 20:47115466-47115488 GTTCAGAAGTTACTTCCTCGAGG 0: 1
1: 0
2: 0
3: 21
4: 168
1173966319_1173966321 20 Left 1173966319 20:47115424-47115446 CCTGTTATTCACTGGGAGGCTCA 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1173966321 20:47115467-47115489 TTCAGAAGTTACTTCCTCGAGGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173966319 Original CRISPR TGAGCCTCCCAGTGAATAAC AGG (reversed) Intronic
900849980 1:5135156-5135178 TCAGTCTCTCAGTGAATTACTGG - Intergenic
903572292 1:24315066-24315088 TGTGCCTCCCAGGGGATCACTGG + Intergenic
903934965 1:26889321-26889343 TGAGCCTCCCAGTGGGCAAGGGG + Intronic
909641709 1:77875681-77875703 TCAGCCTCCCAATGTATTACAGG - Exonic
910356271 1:86359774-86359796 TCAGCCTCCCAGTGGATTACAGG + Intronic
913359158 1:117960291-117960313 TCAGGCTCCCAGTCAATAACAGG - Exonic
914387615 1:147186859-147186881 TAAGCTTCCCAATGAAAAACAGG + Exonic
917706652 1:177641615-177641637 TTGGCCTCCCAGTGAATTTCAGG + Intergenic
921080111 1:211732338-211732360 CCAGCCTCCCCGTGAGTAACAGG - Intergenic
922614648 1:226954649-226954671 TGAGCCAGCCAGAGAATAGCAGG + Intronic
923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG + Intronic
923463331 1:234226415-234226437 TGAGCTTCCCCGAGAATAAGTGG - Intronic
924187777 1:241514207-241514229 TGAGACTACCAGTGACTGACTGG + Intronic
1063693743 10:8312676-8312698 TGTGCCTCCAAATGAATAAATGG - Intergenic
1064045560 10:12011481-12011503 TCAGCCTCCCAAGCAATAACTGG - Intronic
1068861012 10:61848054-61848076 TGAGAGTCCCATTGAATAAAAGG + Intergenic
1069622695 10:69847622-69847644 TAAGCCTCCCAATAAATAACAGG + Intronic
1070699927 10:78594468-78594490 TGACCCTGCCAGTGAATCATGGG + Intergenic
1072306996 10:94117210-94117232 TGAGCTTCCCAGTGAATAAAAGG + Intronic
1075544797 10:123347048-123347070 TCAGCCTCCCCGTGTCTAACAGG + Intergenic
1077117581 11:892200-892222 TCAGCCTCCCCGGCAATAACGGG - Intronic
1080277952 11:30524133-30524155 TCAGCCTCCCACTGAGTAGCTGG - Intronic
1081943784 11:46969486-46969508 TGTGCCTAGAAGTGAATAACTGG - Intronic
1091265577 11:134268786-134268808 TGAGCCCTCCAGAGAATAAAGGG + Intergenic
1096875938 12:54630641-54630663 TGTGGCTCCAAGTGAATAAAAGG + Intergenic
1097509204 12:60515141-60515163 TGAGTCTACCACTGAGTAACTGG + Intergenic
1102035886 12:109770187-109770209 TGGGCCTCCCAGTTAAAACCAGG - Exonic
1105200860 13:18175181-18175203 TGACTCTCCCATTGAATAGCAGG + Intergenic
1107710336 13:43144952-43144974 TGTGGCTCCCAGTGAATATCAGG + Intergenic
1111345534 13:86948346-86948368 TAAGCCTTCCAGTCAACAACAGG + Intergenic
1113949002 13:114060821-114060843 TGAGGCTCCCTGTGAAGAGCAGG + Intronic
1117282275 14:54252878-54252900 TGAGACTCCCAGGGCATGACTGG - Intergenic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1120607673 14:86599385-86599407 GGAGCCTCCCAGTTCATCACTGG - Intergenic
1202923677 14_KI270724v1_random:5696-5718 TGAGGCTCCCAGTCACTCACCGG - Intergenic
1131057124 15:89381764-89381786 TGAGGCCCCCAGTGAGAAACAGG - Intergenic
1140116110 16:72042972-72042994 TCAGCATCTCAGTGAATGACTGG - Intergenic
1140893776 16:79307353-79307375 TGTGCCTCCCACTGAACAAGGGG - Intergenic
1141343802 16:83227401-83227423 TGGGCCTCCCAGGAAATACCTGG + Intronic
1143477137 17:7209116-7209138 TGAGCCTCAGAGTGAATTTCTGG + Intronic
1148096409 17:45055491-45055513 TCAGCCTCCCACTGAATAGCTGG + Intronic
1149556563 17:57577522-57577544 TGAGCATGGCAGTAAATAACTGG - Intronic
1151752463 17:76047669-76047691 TCAGCCTCCCACTGAGTAGCTGG - Intronic
1152158682 17:78652973-78652995 TGAGAATCCCAGAGAAAAACGGG - Intergenic
1153659665 18:7315732-7315754 TGAGCCTACCTGTGAAGATCTGG - Intergenic
1154411649 18:14145097-14145119 TCAGCCCCTCAGAGAATAACAGG + Intergenic
1156465498 18:37345909-37345931 TGAGGCTCCCAGTGCATGCCTGG + Intronic
1157729432 18:49990891-49990913 TGAGCCTCCCAGAGGAGAACGGG - Intronic
1160060439 18:75524819-75524841 TGACCCTCCCAGCGACTAGCTGG + Intergenic
1163119867 19:15211014-15211036 TCAGCCTCCCATGGAATTACAGG + Intergenic
1164435413 19:28224373-28224395 TGGGCCTCCCAGTGTGTACCAGG + Intergenic
1165335164 19:35164661-35164683 TCAGCCCCCCAGTGAATGAATGG + Intronic
1166491195 19:43261993-43262015 AGAGCCTCCCTGTGACTCACAGG - Exonic
925032515 2:661686-661708 TGAGCCTCCCAGTGTCCAGCAGG + Intergenic
928198901 2:29234447-29234469 TGATCTTCCCAGAGAAGAACTGG - Intronic
934116620 2:88803691-88803713 TGACTCTCCCATTGAATAGCAGG - Intergenic
934577535 2:95412532-95412554 TGGGTCTCCCAGTGAGTGACAGG + Exonic
934625990 2:95852864-95852886 TGACTCTCCCATTGAATAGCAGG + Intronic
934668534 2:96191549-96191571 TGAGTCTCTCAGTGCATACCTGG + Intronic
934807583 2:97248454-97248476 TGACTCTCCCATTGAATAGCAGG - Intronic
934829927 2:97508733-97508755 TGACTCTCCCATTGAATAGCAGG + Intronic
936267473 2:111021539-111021561 AGAGTCTCCCAGAGAATAAGGGG - Intronic
938541639 2:132288114-132288136 TGAGTCTCCCAGAGACTCACAGG - Intergenic
939488914 2:142853063-142853085 TCAGCCTCCCACTGAGTAGCTGG - Intergenic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
942495985 2:176540537-176540559 TCAGCCTCCCAGTGCATCAGTGG - Intergenic
947446200 2:230164503-230164525 TCAGCCTCCCAGTGAGGAACTGG - Intergenic
947591165 2:231386831-231386853 TGAGCCTCCCAGTAAAGCCCCGG - Intergenic
1170596344 20:17808772-17808794 TGAGCTTCTCAGTGAAAAAGTGG - Intergenic
1171140208 20:22734527-22734549 TTAACCTCCCAGCAAATAACAGG + Intergenic
1171178596 20:23074594-23074616 TGTGCTTCCCAGTGAACCACAGG + Intergenic
1173966319 20:47115424-47115446 TGAGCCTCCCAGTGAATAACAGG - Intronic
1174339458 20:49886868-49886890 TCAGCCTCCGAGTGAAGAAGGGG - Exonic
1176861412 21:14013330-14013352 TCAGCCCCTCAGAGAATAACAGG - Intergenic
1178423506 21:32460651-32460673 TGAAACTCACAGTGAATATCAGG - Intronic
1178994546 21:37386771-37386793 AGAGCCTGCCAGTGACTAAAGGG - Intronic
1179109119 21:38430803-38430825 TCAGCCTCCCTATGAATAGCTGG + Intronic
1179558509 21:42195814-42195836 AGAGCATCCCAGTGGAGAACTGG + Intergenic
1182371158 22:29812046-29812068 TGAGCCTCCCAGAGAATGTTAGG - Intronic
1182570866 22:31236797-31236819 TCAGCCTCCAAGTGAGTAGCTGG - Intronic
1182833240 22:33320854-33320876 TGAGGCTGCCAGTGACTCACCGG - Intronic
1184749002 22:46473491-46473513 GGAGACTCACAGTGAATAAGTGG - Intronic
949386292 3:3506008-3506030 TCAGCCTCCAAGCCAATAACTGG - Intergenic
950581098 3:13862623-13862645 GGAGCCTCTCAATGAATAACTGG + Intronic
954130877 3:48560313-48560335 TGAACCTCCCAGTGGACAGCAGG - Intronic
959717503 3:109449401-109449423 TAAGTCTCCCAGTGAAGAAAAGG + Intergenic
960703243 3:120457715-120457737 TCAGCCTCCCAAAGAATAAATGG + Intergenic
963082725 3:141409461-141409483 TGAGCCTCTCAGTTAAAATCAGG - Intronic
967825261 3:193872433-193872455 TCAGCCTCCCAGAGAGGAACAGG + Intergenic
971382353 4:26110591-26110613 TCAGCTTCCCAAAGAATAACCGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975742949 4:77448202-77448224 TGAGCTTCCCAGTGAAAAGGTGG - Intergenic
980169918 4:129276640-129276662 AGAGAATCCCAGTGAATAAGTGG - Intergenic
980935507 4:139221895-139221917 AGAGACTCCCAGGGAATATCTGG + Intergenic
983026498 4:162743863-162743885 TCAGCCTCCCACTGAGTAGCTGG - Intergenic
985352643 4:189082687-189082709 TAAGACTCCAAGTGAATCACTGG - Intergenic
987220540 5:15786531-15786553 TGAGCCTCCCAGAAAAGAACAGG - Intronic
992305616 5:75434237-75434259 TGATCATCTCAGTGGATAACAGG - Intronic
992406464 5:76462110-76462132 GGAGCCTCCCAGGAAATCACGGG + Intronic
993462310 5:88198538-88198560 TGAGGCTTCCAGAGAATAAAAGG - Intronic
995848005 5:116514783-116514805 AGAGCCTCCCAGTAGAAAACAGG - Intronic
1001055273 5:168444389-168444411 TGACCCTCCCAGTGAATTGATGG - Intronic
1002008342 5:176254575-176254597 TCAGTCTACCAGTGTATAACAGG + Intronic
1002218377 5:177657697-177657719 TCAGTCTACCAGTGTATAACAGG - Intergenic
1002998363 6:2307896-2307918 TGAGCAACTCACTGAATAACCGG + Intergenic
1005204592 6:23387127-23387149 TGAGGCTTCCAGTGAATAGTAGG + Intergenic
1006647675 6:35526284-35526306 AGAGCCTCCCTGTGAAAACCCGG - Intergenic
1006667889 6:35710359-35710381 TGATCCTCCCACTGAGTAGCTGG - Intronic
1007264905 6:40588658-40588680 TGTGCCTCCCTGTGGGTAACCGG - Intergenic
1008087251 6:47258115-47258137 TCAGCCTCCCAAAGAATTACAGG - Intronic
1010774143 6:79865648-79865670 TGAACTGACCAGTGAATAACTGG + Intergenic
1014260904 6:119215972-119215994 TGAACCTGCCAGTGAAGACCTGG + Intronic
1018967026 6:168497217-168497239 TGAGGCTCCCAGTGACCACCGGG - Intronic
1023743594 7:43302362-43302384 TCAGCTTCCCGGTGAATAAGAGG + Intronic
1023850883 7:44149700-44149722 TGAGGCTCCCTGTGTACAACAGG - Intronic
1026294381 7:69038438-69038460 TCAGCCTCCCAGAGAGTATCTGG + Intergenic
1026885702 7:73942863-73942885 TCCCCCTCCCAGTGAATAATTGG + Intergenic
1027719512 7:81722139-81722161 TGAGCATCAAAATGAATAACAGG - Intronic
1031837759 7:126699143-126699165 TTAACCTCCCAGTGAATTAATGG + Intronic
1032614235 7:133448988-133449010 TCAGCCTCCTACTGAATAGCTGG - Intronic
1036382762 8:8248608-8248630 TCAGCCTCCCTGTGAGTAGCTGG - Intergenic
1036542399 8:9729889-9729911 TCAGCCTCCCAGCGAGTAGCTGG + Intronic
1037589605 8:20302127-20302149 TGTGCCTGCCAGTGAAGAAACGG - Intronic
1038974560 8:32679037-32679059 TCAGCCTCCTAGTGAGTAGCTGG - Intronic
1042426947 8:68660284-68660306 TTATCTTCCCAGTGAATACCAGG + Intronic
1047267382 8:123319062-123319084 TCAGCCTCCCAGGGAATAGCTGG + Intergenic
1050766286 9:9139137-9139159 TGAGACTCCTAGTGAATACCTGG + Intronic
1054800871 9:69347131-69347153 TGGGCCTCCCAGGAAATAGCAGG + Intronic
1055374887 9:75637933-75637955 TCAGCCTCCCACTGAGTAGCTGG + Intergenic
1056350499 9:85744041-85744063 TCAGCCTCCCACTGAGTATCTGG + Intergenic
1056837989 9:89973092-89973114 TGGGCCTTCCAGTGAAGAAAGGG - Intergenic
1059612441 9:115913553-115913575 TGATCCTCCTAGTGAGAAACAGG + Intergenic
1203583492 Un_KI270746v1:38765-38787 TGACTCTCCCATTGAATAGCAGG - Intergenic
1186961904 X:14745611-14745633 AGAGCCTCCCAGTAAAACACTGG - Intergenic
1187159250 X:16749168-16749190 TCAGCCTCCCTATGAATAGCTGG + Intronic
1187199297 X:17119770-17119792 TGAGCCCCCCAGGGGAAAACTGG - Intronic
1188262133 X:28034481-28034503 TAAGCGTCCCTGTGCATAACGGG + Intergenic
1193671302 X:84389714-84389736 TGTGCCTCCCAGAGAAAAATGGG + Intronic
1201766763 Y:17579819-17579841 TGAGCCTCCCAATGCACAGCGGG + Intergenic
1201834790 Y:18326166-18326188 TGAGCCTCCCAATGCACAGCGGG - Intergenic