ID: 1173968305

View in Genome Browser
Species Human (GRCh38)
Location 20:47130620-47130642
Sequence CTTTGTCATGTCTTCTATTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173968305_1173968308 13 Left 1173968305 20:47130620-47130642 CCGCAATAGAAGACATGACAAAG 0: 1
1: 0
2: 2
3: 17
4: 245
Right 1173968308 20:47130656-47130678 CCACCCACTTCTCATTTAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173968305 Original CRISPR CTTTGTCATGTCTTCTATTG CGG (reversed) Intronic
903910065 1:26717260-26717282 TTTTGCCATTTCTCCTATTGAGG + Intronic
907495403 1:54840986-54841008 ATTTCTCATTTCTACTATTGAGG - Intronic
911685187 1:100767565-100767587 CATTTTTATGTCTTCTCTTGAGG - Intergenic
912633306 1:111267849-111267871 CCTTGTGATCTCTTCTACTGTGG + Intergenic
912639803 1:111333797-111333819 CTTGGTACTGTCTTCTTTTGGGG + Intergenic
917268153 1:173243584-173243606 CTTTTTCATGTTTTGTTTTGGGG - Intergenic
918334949 1:183499907-183499929 CTTTGTTATGTCTTCTAAGGTGG + Intronic
919356691 1:196533698-196533720 AATTCTTATGTCTTCTATTGTGG + Intronic
920213611 1:204346460-204346482 CTTTGTCATGGCTTCCCCTGTGG - Intronic
920731082 1:208485633-208485655 CTTCGTCATGTGTTATTTTGGGG + Intergenic
921153824 1:212422713-212422735 CTTTGTCAAGTCCCCTATTGTGG + Intergenic
921968882 1:221122905-221122927 CTGTGTTATGTCTATTATTGAGG + Intergenic
922651537 1:227343579-227343601 CTTTAGCTTTTCTTCTATTGAGG + Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1063583422 10:7329935-7329957 CTTTGACATTTCTTGCATTGAGG - Intronic
1063836239 10:10016773-10016795 CATTGGTATGTCTTCTTTTGAGG + Intergenic
1065195423 10:23260142-23260164 GTTTGTAATGTCTTTTATTTTGG - Intergenic
1065404969 10:25353914-25353936 CTTTTTATTGTCTTCTTTTGTGG + Intronic
1066685134 10:37974472-37974494 CATTTGTATGTCTTCTATTGTGG - Intronic
1069003049 10:63286956-63286978 GTTTCTCGTGTCTTCTTTTGAGG - Intronic
1070066595 10:73041132-73041154 TTTCTTCATGTCTTCTAATGGGG + Intronic
1071668929 10:87589111-87589133 CTTTTTCATCTCTTTTATTTGGG + Intergenic
1071896467 10:90072940-90072962 TTTTGTCGTGTCTTGTTTTGTGG + Intergenic
1072254299 10:93606243-93606265 TTTTGTCGTGTTTTCTTTTGAGG - Intergenic
1072693365 10:97585801-97585823 CTTTGTTGTGGCTGCTATTGAGG + Intronic
1073598292 10:104821692-104821714 CTTTGTTTTCTCTTCTATTCTGG + Intronic
1074522378 10:114237371-114237393 ATTTGGCATGTCTTTAATTGGGG - Intergenic
1080167690 11:29259796-29259818 CTTTGTCCTTTTTTCCATTGTGG + Intergenic
1082944032 11:58739437-58739459 CTTTGGAAGGTCTTCTATTTGGG + Intergenic
1084909941 11:72380380-72380402 CTTTGTGATTTCTTCTAGTGTGG - Exonic
1086065501 11:82739295-82739317 CTTTGTCTTTTCTTCCATTAAGG - Intergenic
1088388197 11:109282624-109282646 TTTTATCATGTGTTCTATTATGG - Intergenic
1088511281 11:110578280-110578302 CTTTGTTGGGTATTCTATTGTGG + Exonic
1089726584 11:120485868-120485890 CATTGTCGTCTTTTCTATTGAGG + Exonic
1090949433 11:131460197-131460219 CTAGGTCATGTCTTCTGATGAGG + Intronic
1092906250 12:13102481-13102503 CTTTGTCATCTATTCACTTGGGG + Intronic
1093470501 12:19496343-19496365 TTTTGTCATCTGTTTTATTGAGG + Intronic
1096995677 12:55836714-55836736 CTGTGTCATCTCTTCTCTGGAGG - Exonic
1098850203 12:75587271-75587293 CTCTCTCATGTCTCCTATTTAGG + Intergenic
1100117690 12:91328255-91328277 CTTTTTCTTTTCTTCTTTTGGGG + Intergenic
1100162250 12:91874134-91874156 CTTAGTCATGTGTTGTATTAGGG + Intergenic
1101169413 12:102074090-102074112 CTTAGTCATCTCTTCTCTGGAGG + Exonic
1102126843 12:110489680-110489702 CCTTCTCATCTCTTCTATTGGGG - Intronic
1103678253 12:122673568-122673590 CTTTGTTAAGTCTTCTTTTCAGG + Intergenic
1103982742 12:124747034-124747056 CTTTGTGATTTCATCTTTTGGGG + Intergenic
1105716440 13:23070151-23070173 CTTTATTATGTCTTTTATTCTGG - Intergenic
1106108534 13:26756916-26756938 CTTTGTCAAGTCTCCTATGGTGG + Exonic
1107377685 13:39822090-39822112 CATTTTCATTTCTTCTTTTGGGG - Intergenic
1107745457 13:43502376-43502398 CTTTGTCTTGGTTTGTATTGGGG - Intronic
1108081601 13:46742609-46742631 CCTTGTTAGGTCTTCTCTTGAGG + Exonic
1108986370 13:56593501-56593523 TTTTGTCATTTATTCTATTGAGG + Intergenic
1109164771 13:59020398-59020420 CTGTGTCGTCTCTTCTTTTGAGG - Intergenic
1109517751 13:63466183-63466205 CTTTGTCAGGTATTTTATTTTGG - Intergenic
1109776754 13:67051295-67051317 CTTTGTGATGTCATCTTTTTGGG + Intronic
1109794559 13:67293071-67293093 CTTCATCATATCTTCTATGGAGG + Intergenic
1110134414 13:72047829-72047851 CTGTGTCTTCTCTTCTTTTGAGG + Intergenic
1110163933 13:72414290-72414312 CTTGTTCATGTCTTCTGTTAGGG - Intergenic
1110345401 13:74441796-74441818 CATTTTTATGTCTTCTATGGAGG + Intergenic
1110866140 13:80398408-80398430 GTTTGTACTGTCTTCTTTTGTGG + Intergenic
1110980586 13:81891644-81891666 CTTTTTTATGTCTTCCTTTGAGG - Intergenic
1111023642 13:82489461-82489483 ATTTGTCTTGTTTTCAATTGAGG + Intergenic
1113484505 13:110644593-110644615 CTTTCTCCTGGCTTCTATGGAGG + Intronic
1116586979 14:46718244-46718266 CTTTTTCCTATCTTCTCTTGGGG + Intergenic
1120126765 14:80753670-80753692 CTTTGTCCTTGCTTCTCTTGGGG + Intronic
1121903411 14:97716090-97716112 CTTTTGCCTGTCTTCTAATGTGG + Intergenic
1123455700 15:20422370-20422392 CATTTATATGTCTTCTATTGAGG + Intergenic
1125090463 15:35785065-35785087 CTTTGTTATGTTTTCTGATGTGG + Intergenic
1125446104 15:39758777-39758799 CTTTGTAATATATTTTATTGGGG - Intronic
1128064748 15:64757527-64757549 CTCTGTGGTGTCTTCTATTTCGG - Intronic
1131074814 15:89488691-89488713 TTTTGTCATGTCTTTTAATCTGG - Intronic
1131828406 15:96338329-96338351 GTTTGTCATGGTTTCTTTTGGGG - Exonic
1133576387 16:7095450-7095472 TTTTGTCATGAGTTCTATTAAGG - Intronic
1134476311 16:14576946-14576968 CTTTATCAAGTCAACTATTGAGG - Intronic
1136509716 16:30729376-30729398 CTTTGTCATGCCTCCTGTGGAGG + Exonic
1136657307 16:31717563-31717585 TGCTGTCAGGTCTTCTATTGAGG + Intronic
1136673608 16:31879298-31879320 TGCTGTCAGGTCTTCTATTGAGG + Intronic
1137915506 16:52425562-52425584 CTTTGTTCTGTGTTCTACTGGGG - Intergenic
1137919129 16:52468681-52468703 CTTTGTCATGTTTTGCATTTGGG - Intronic
1139061119 16:63252995-63253017 ATTTGCCATGTCTTCTACTTAGG + Intergenic
1140554281 16:75903346-75903368 ATTTTTCATTTCTTCTATTGTGG + Intergenic
1142431353 16:90029658-90029680 CGTTGTCTTGTCTTCTTTTGAGG + Intronic
1143721557 17:8814615-8814637 CTTTGTCATTTCTTCAATTTTGG - Intronic
1146295262 17:31645144-31645166 CTCTGTCATTTGTTCTATTCAGG - Intergenic
1148244700 17:46022979-46023001 CTTTGTCATGTCATGTTTTGTGG + Intronic
1149276402 17:55043556-55043578 TTTGCTCATGTCTTCTGTTGAGG + Intronic
1149455542 17:56785306-56785328 ATGTGTCTTGTCTTCTCTTGTGG - Intergenic
1149580443 17:57746541-57746563 CTATGTGATGTCTTCTGCTGTGG + Intergenic
1154650905 18:17060860-17060882 CTTTGTGATGTTTTGTATTCAGG + Intergenic
1155074040 18:22339730-22339752 CTTTCTCATTTCTTTTAATGGGG + Intergenic
1157827810 18:50828431-50828453 TTTTTTCATGTATTCTGTTGGGG - Intergenic
1159476380 18:68925440-68925462 CCTTGTCATGTCCTCCACTGAGG + Intronic
1160089585 18:75813882-75813904 CTTGGTCATGTCTAATATTGAGG + Intergenic
1160987541 19:1846152-1846174 CTTTGCCATGTCTTCTCAAGGGG - Intronic
1163067641 19:14810707-14810729 CTTTGTCCTGGCTTCTATTCTGG + Intronic
1165084983 19:33338647-33338669 CTTTAGCATTTCTTCTAGTGTGG - Intergenic
1166600798 19:44093006-44093028 CTTTGTCTTGTTTTGTTTTGAGG - Intergenic
926480173 2:13382845-13382867 CATTTATATGTCTTCTATTGAGG - Intergenic
926512727 2:13802670-13802692 CTTTAACATATCTTCTTTTGGGG - Intergenic
926950758 2:18240569-18240591 TTTTTTGATGTCTGCTATTGAGG + Intronic
929532821 2:42763219-42763241 CTTTGGCATGGCTTCCATGGTGG - Exonic
929837372 2:45417479-45417501 CTTTATAATGTATTCTAGTGAGG + Intronic
930497212 2:52160856-52160878 CTTTGCCATGTCTTTTTTTGAGG + Intergenic
933181001 2:79227552-79227574 CTTTGATATGTGTTTTATTGTGG - Intronic
933966957 2:87437813-87437835 CTTTGTCATGTCTGTGATTAAGG + Intergenic
935723781 2:106004496-106004518 CTTTCTATTGTCTTCTTTTGTGG + Intergenic
936326840 2:111512684-111512706 CTTTGTCATGTCTGTGATTAAGG - Intergenic
937425034 2:121791603-121791625 TTTTTTCATGTCTTCTATACAGG - Intergenic
939227875 2:139386351-139386373 ATTTATCATTTCTTCTATAGGGG + Intergenic
940064347 2:149610423-149610445 TTTTATCATTTCTTCTTTTGTGG - Intergenic
940567329 2:155383947-155383969 CTTTGTCATTTCCACTCTTGAGG + Intergenic
940628693 2:156209832-156209854 CTTTATCCAGTCTACTATTGAGG + Intergenic
940743383 2:157538630-157538652 CTTTCTCATTTCCTCTATCGAGG + Exonic
941647938 2:168061617-168061639 CTTTGTTATATTTTCTCTTGTGG - Intronic
943491871 2:188563793-188563815 CTTTGTCATGTTTTCAATCAGGG - Intronic
943675712 2:190714876-190714898 CTGTTTCTTGTCTTCTATTTTGG - Intergenic
945336878 2:208602813-208602835 CATTTGCATGTCTTCTTTTGAGG - Intronic
945845641 2:214940980-214941002 CTTAGTCATTTCTTGTATTCTGG + Intronic
946099265 2:217305158-217305180 GTTTGTTATGAGTTCTATTGGGG - Intronic
946239818 2:218346599-218346621 CTTTGTCAATGCTTCTCTTGTGG + Exonic
946587618 2:221207968-221207990 CTTTGTCATGTTTTCATGTGAGG - Intergenic
946774390 2:223122669-223122691 TTTTCTATTGTCTTCTATTGGGG + Intronic
947380092 2:229536957-229536979 ATTTGGCATGTGTTGTATTGGGG - Intronic
948470826 2:238177296-238177318 GTTTTTCATGTTTTTTATTGTGG + Intronic
1170303517 20:14912470-14912492 CTTTGTCAAGTTTCCTGTTGGGG + Intronic
1171172203 20:23025626-23025648 CTTTGTCCTGTCCTCACTTGGGG - Intergenic
1171794124 20:29553203-29553225 CTTTGTTTTGTCTTCTCTTAGGG - Intergenic
1172438856 20:34951178-34951200 CTTTCTAATGCCTTCTATTAGGG - Intronic
1173216727 20:41092129-41092151 CTCTGTCATGTATGCCATTGTGG + Intronic
1173968305 20:47130620-47130642 CTTTGTCATGTCTTCTATTGCGG - Intronic
1178159991 21:29901171-29901193 CTTTGTCCTGCTTTCTCTTGTGG - Intronic
1179393892 21:41020117-41020139 CTTTAACATGTCTTCTTCTGTGG - Intergenic
1181425334 22:22833900-22833922 CTGTGTTTTGTCTTCTAGTGTGG + Intronic
1181842402 22:25675148-25675170 CTTTGTCATGTGATCTGATGGGG - Intronic
1181873661 22:25923096-25923118 CTATGGCATGTCTTCTAATCTGG + Intronic
1183107663 22:35626568-35626590 CTTGTTCATGTCATGTATTGTGG - Intronic
1183751881 22:39725563-39725585 CTGAGTCATGTCTGCTATTCGGG - Intergenic
949818051 3:8083012-8083034 CTTTGTCATATACTCTATTTTGG + Intergenic
951293731 3:20906507-20906529 TTTTGTCATGTTTTCTTATGAGG - Intergenic
952095107 3:29941706-29941728 CTTTGGCATTTTATCTATTGAGG - Intronic
953081820 3:39627834-39627856 CTTTGTACTGTCTTCCATAGTGG - Intergenic
955874036 3:63471682-63471704 CTTTTTTATGGCTACTATTGAGG + Intronic
956964625 3:74444264-74444286 CTTCATCATGTCTCTTATTGGGG + Intronic
957567014 3:81897010-81897032 GTTGGTCATCTCTTCTCTTGGGG - Intergenic
959161231 3:102726793-102726815 AATTGTCATGTCTTCTTTTTTGG + Intergenic
961416320 3:126760311-126760333 TTTTTTCAGTTCTTCTATTGTGG + Intronic
961865238 3:129949060-129949082 CTTTGACATATCTTCTGTTGGGG + Intergenic
962726162 3:138229383-138229405 ATTTGTCCAGTCCTCTATTGTGG + Intronic
964158677 3:153618990-153619012 CTTTGTTATTTTTTCTATTATGG - Intergenic
965709765 3:171545448-171545470 CTTACTCAAGTCTTCTCTTGAGG + Intergenic
966839672 3:184078269-184078291 CTTTTCCATGGCTTCTAATGAGG + Intergenic
967855068 3:194111156-194111178 CTCTGGCATGTCTTCTTATGAGG - Intergenic
971982477 4:33770644-33770666 CTTTGTCATGTCTCAAATTGGGG - Intergenic
972643576 4:40947105-40947127 CTTTGTCCTGTCTCCTTTTCAGG + Intronic
974764247 4:66321447-66321469 CATTGTAATGTGTGCTATTGAGG + Intergenic
974852872 4:67424917-67424939 CTTTATCATTTGTTTTATTGTGG - Intergenic
975472539 4:74786795-74786817 ATTTCTCATGTTTTGTATTGAGG - Intronic
975983168 4:80182246-80182268 CTTTGTCATGTTTTTTTCTGAGG - Intergenic
976360430 4:84172056-84172078 CTTTGTCATGTGACCTATTTTGG - Intergenic
977595905 4:98879966-98879988 CTATATTATGTCTTCTTTTGTGG - Intronic
977604611 4:98970556-98970578 CTTTGTCATGTCTTCCAAGTAGG - Intergenic
979465225 4:121029608-121029630 ACTTGTCATGTATTCTATTCTGG + Intergenic
979570184 4:122213825-122213847 CTTTGTCATTTCTTCTGTTGTGG + Intronic
979930401 4:126623070-126623092 TTTTGTCATGTTTGCTGTTGAGG - Intergenic
980313126 4:131161809-131161831 CATTGTCATATTTTGTATTGGGG + Intergenic
980337062 4:131489561-131489583 CTCTGACATGTCTTTTATTTAGG + Intergenic
984461018 4:180036620-180036642 CTTTCCCATGTCTTCTCTTCTGG + Intergenic
984602769 4:181747426-181747448 CTTTGTCCTGTCTTCCCTAGTGG + Intergenic
985330104 4:188822781-188822803 CTTTCTGATGTCCTCTACTGTGG - Intergenic
986328234 5:6696976-6696998 CTTTGTTATTTCTTTTGTTGTGG + Intergenic
989033737 5:37147574-37147596 CTTTATTATTTCTTCTATTTTGG - Intronic
989498472 5:42137827-42137849 CATTTGCATGTCTTCTTTTGAGG - Intergenic
989555031 5:42784162-42784184 CTTTGTAATGTTTTCCATAGGGG + Intronic
989975171 5:50577003-50577025 CTTTGTCACATCTGTTATTGGGG + Intergenic
990154583 5:52861082-52861104 CTTTATCATATTTTTTATTGGGG - Intronic
991515997 5:67436227-67436249 CTTTGTCATGTCTTATGCTTTGG + Intergenic
992187494 5:74258173-74258195 CATTTGCATGTCTTCTTTTGAGG + Intergenic
993370151 5:87083342-87083364 TTTTGTCATGTTTTAAATTGTGG - Intergenic
993818443 5:92583116-92583138 GTGAGTCATGTCTACTATTGGGG + Intergenic
993840169 5:92867853-92867875 TTTTGTCATTTTTTCTATTTAGG + Intergenic
993908547 5:93651541-93651563 TTCTGTCATGTCTTGTAATGTGG - Intronic
994514097 5:100748425-100748447 CTTTGACATTTTTTCCATTGTGG + Intergenic
995275479 5:110273397-110273419 CATTCTCTTATCTTCTATTGTGG - Intergenic
999581785 5:153046872-153046894 TTTTGTCATTATTTCTATTGTGG + Intergenic
999702734 5:154242905-154242927 CTTTGTTATTTGTTCTATTTTGG + Intronic
999875654 5:155802992-155803014 TTTTGTCATGTCTTCTTTCTAGG - Intergenic
1000437560 5:161231571-161231593 CTTTCTCATGTCTCTTCTTGTGG + Intergenic
1002403834 5:179012998-179013020 CTGTGTCATTTATTCAATTGAGG - Intergenic
1005531968 6:26716848-26716870 ATTTGTCCTGCCTTCTCTTGAGG + Intergenic
1005538827 6:26784817-26784839 ATTTGTCCTGCCTTCTCTTGAGG - Intergenic
1007963908 6:45986040-45986062 CATGGTCATGTCTTAGATTGTGG - Intronic
1008036586 6:46751959-46751981 CTTTGTCATGTCTGACATTTTGG - Exonic
1008191202 6:48460750-48460772 CTATGTCTTGTCTTCTGTAGTGG + Intergenic
1008213285 6:48752640-48752662 TTTTGAGATGTCTTCTAGTGAGG - Intergenic
1008246155 6:49176190-49176212 CTTTGTCTTGTCTTCTGTAAAGG + Intergenic
1008433573 6:51449041-51449063 CTTTGTCTTGTTTTCTAGGGCGG - Intergenic
1009009677 6:57827044-57827066 ATTTGTCCTGCCTTCTCTTGAGG - Intergenic
1009010446 6:57835501-57835523 ATTTATCTTGTCTTCTTTTGAGG - Intergenic
1011435369 6:87330320-87330342 TTTTGTTTTGTCTTCTATTGAGG + Intronic
1013462215 6:110385862-110385884 CTTGTTCATGGATTCTATTGGGG - Intergenic
1015069456 6:129073557-129073579 ATTTGTCTTCTCTTCTTTTGAGG + Intronic
1015076152 6:129160077-129160099 TTTTGTCAGGTTTTTTATTGGGG + Intronic
1017036563 6:150272463-150272485 CATTGTCAGCTCTTCTCTTGGGG - Intergenic
1017365833 6:153636450-153636472 CATTTGCATGTCTTCTTTTGAGG + Intergenic
1017983729 6:159424640-159424662 CTGTGTCTTCTCTTCTAATGTGG + Intergenic
1019002065 6:168762516-168762538 TTTTGTCATGGCTTTTACTGGGG + Intergenic
1020393715 7:7688878-7688900 CTTGGTAATATCTTCTATTAAGG + Intronic
1021341743 7:19472377-19472399 CCTTGTAATGTCTTCTGTTTTGG - Intergenic
1022811934 7:33877949-33877971 CTTTGTATTGTCTCTTATTGTGG + Intergenic
1024443749 7:49453306-49453328 CAATGTCATGTCTTATATGGTGG + Intergenic
1024766482 7:52667114-52667136 CTTTGTGATGTCCTCTATTGGGG + Intergenic
1027222882 7:76225254-76225276 CTTTCTGCTGTCTTCTACTGGGG - Intronic
1027875978 7:83769138-83769160 CTTTGTCATTTATTCAATTTAGG + Intergenic
1028956686 7:96701399-96701421 CTTTGTGCTGTGTTCTCTTGTGG - Intronic
1030567110 7:111171538-111171560 TTTTGCCATGTTTTCTTTTGAGG - Intronic
1032935533 7:136726972-136726994 TTTTGTCATGTTTCCTTTTGAGG - Intergenic
1033901093 7:146141271-146141293 CTTGATTATGTCTTCTAATGTGG + Intronic
1035422418 7:158740731-158740753 CTTTCTCATGTCCACTATTTTGG - Intronic
1036540533 8:9703734-9703756 ATTTTTCCTGTCTTCTATTTGGG - Intronic
1037046448 8:14310759-14310781 CTGTATTATGTCTTCTTTTGTGG + Intronic
1037353858 8:17996603-17996625 CTTTATTATTTCTTCTATTTTGG + Intronic
1037406769 8:18550873-18550895 CTCTGTCATGTCTTCTGTAAAGG + Intronic
1037573855 8:20182081-20182103 CTTTGACGTGGCTTCTGTTGTGG + Intronic
1037625329 8:20601482-20601504 CTTTGTCATGTCATCTGTGATGG + Intergenic
1037757902 8:21723285-21723307 GTTCTTCATGTCTTCTACTGGGG + Intronic
1039198936 8:35064787-35064809 ATTTGTTAAGACTTCTATTGTGG - Intergenic
1041171455 8:55146656-55146678 CTTTTTCATGTCTTTTAAAGGGG + Intronic
1044019425 8:87086029-87086051 CTTTTTCAGGTCTTTTAGTGAGG + Intronic
1044189587 8:89299185-89299207 ATTTGTAATGTCTTGTTTTGTGG - Intergenic
1044192687 8:89338065-89338087 CTTTGTCTGGTTTTCTATTAGGG + Intergenic
1044796172 8:95900293-95900315 CTTTAACATCTCTTATATTGAGG - Intergenic
1046482740 8:114844166-114844188 CTTTATTTTGTCTTCCATTGTGG - Intergenic
1046786633 8:118273528-118273550 CTTTGTCCAGTCTGTTATTGTGG - Intronic
1047936269 8:129782873-129782895 CTTTGTCTTGTTTTTTATTAGGG - Intronic
1048123248 8:131605327-131605349 TTTCCTCATGTCTTGTATTGAGG - Intergenic
1049074228 8:140381361-140381383 CTTTGTCAAGTTTTAAATTGGGG - Intronic
1050483473 9:6109837-6109859 TTTTGTCATCTGTTCTCTTGGGG - Intergenic
1052084131 9:24243005-24243027 CTTTGTCTTGTGTGCTATTCTGG + Intergenic
1052968092 9:34357143-34357165 CTTTGTGATGTCTTTGATTATGG + Intergenic
1055631100 9:78224299-78224321 CCTTTTCATGTCTTTTATTTTGG + Intergenic
1057568049 9:96182324-96182346 CTTTTCCATGGCTTTTATTGTGG + Intergenic
1057763697 9:97897391-97897413 CTCTGTCATGTCTTCTTCTCTGG + Intergenic
1057984904 9:99703190-99703212 CTTTGTCATCATTTCTATTAGGG - Intergenic
1059771636 9:117432013-117432035 CTTTATCTTTTCTTCTTTTGTGG + Intergenic
1060670976 9:125469085-125469107 CTTTAACATGCCTTCTATAGTGG + Intronic
1061721445 9:132554178-132554200 CACTGTCATGCCTTCTGTTGTGG + Intronic
1062671790 9:137714878-137714900 CTTTGTAATGTCATCCATTTAGG + Intronic
1185971379 X:4668593-4668615 TTTTCTCATGTCTACTTTTGAGG - Intergenic
1186755723 X:12669386-12669408 CTTTTTCATGTTCTCTCTTGAGG - Intronic
1187261438 X:17688171-17688193 CTTCATGATGTCTTCTAGTGAGG - Intronic
1187637156 X:21242399-21242421 CTTAGACATGTCTTTTAGTGGGG - Intergenic
1188773635 X:34186281-34186303 CTTTATCCAGTCATCTATTGCGG + Intergenic
1189013983 X:37076989-37077011 ATTTTTCAGCTCTTCTATTGAGG + Intergenic
1190240805 X:48656422-48656444 CTTTGTCATGTTTTGTAATATGG + Intergenic
1190464793 X:50715545-50715567 ATTTGCCATGTCTTCTTTTGAGG - Intronic
1192170173 X:68849478-68849500 ATGTGCCATGTCTTCTCTTGAGG + Intergenic
1192580186 X:72274652-72274674 CTTTGCCATGTCTCCATTTGTGG - Intronic
1192990675 X:76453122-76453144 ATTTGTTATGACTTCTTTTGTGG + Intergenic
1193165984 X:78280968-78280990 CTTTATCCAGTCTTCTATTCAGG + Intronic
1194539598 X:95154858-95154880 CTATGTCATGTTGACTATTGTGG - Intergenic
1194862260 X:99014742-99014764 CTTTGTCATTACATCTATTATGG + Intergenic
1196854899 X:119973589-119973611 CTTTTTCTTGTTTTCTATTCTGG + Intergenic
1197388848 X:125835935-125835957 CTTTGTTTTGTTTTCTTTTGGGG + Intergenic
1199365446 X:146975524-146975546 CTTTGACATTTCTTACATTGTGG - Intergenic
1201794182 Y:17876838-17876860 CTCTGGCATTTCTTCTTTTGTGG + Intergenic
1201807372 Y:18029147-18029169 CTCTGGCATTTCTTCTTTTGTGG - Intergenic