ID: 1173972615

View in Genome Browser
Species Human (GRCh38)
Location 20:47164329-47164351
Sequence ATTTGTAAGGGGATTGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173972615_1173972626 22 Left 1173972615 20:47164329-47164351 CCCCCAACAATCCCCTTACAAAT 0: 1
1: 0
2: 1
3: 28
4: 246
Right 1173972626 20:47164374-47164396 ATGCCTTTCCTCTGACATCAAGG 0: 1
1: 0
2: 2
3: 32
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173972615 Original CRISPR ATTTGTAAGGGGATTGTTGG GGG (reversed) Intronic
900756901 1:4442076-4442098 ATTTTGAAGGGGACTGTTGCTGG + Intergenic
901303171 1:8214401-8214423 ATATGTAAAGGGAATGTGGGCGG - Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
904115779 1:28160765-28160787 ATCAGTAAGGGGAGTGCTGGTGG + Intronic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
911140445 1:94495677-94495699 ATGTGGAAGGGTATTATTGGAGG + Intronic
911774487 1:101790835-101790857 ATTTTTAATTGGATTGTTTGTGG - Intergenic
911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG + Intergenic
912590777 1:110817599-110817621 ACTTGTAAGAGGAGGGTTGGAGG - Intergenic
912777963 1:112518156-112518178 ATTTGTGGTGGGATTCTTGGAGG + Intronic
913054667 1:115147048-115147070 CTTTTTAACGGGATTATTGGGGG - Intergenic
913265031 1:117035363-117035385 CTTCCTAAGGGGATTATTGGTGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913728805 1:121686538-121686560 ATCTGCAAGGGGACTTTTGGAGG - Intergenic
913744272 1:121884264-121884286 ATTTGCAAGGGGACATTTGGAGG - Intergenic
913749084 1:121941559-121941581 ATCTGTAAGGGGACATTTGGAGG + Intergenic
913768626 1:122221747-122221769 ATCTGTAAGGGGACATTTGGAGG + Intergenic
913772329 1:122271127-122271149 ATCTGCAAGGGGATATTTGGAGG + Intergenic
913785162 1:122442458-122442480 ATCTGTAAGGGGACATTTGGAGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914905910 1:151743779-151743801 TTTTCTAAGTGGATTGTTTGTGG + Intergenic
915283800 1:154840331-154840353 ATTTGCAAAGGTATGGTTGGTGG + Intronic
916906941 1:169296248-169296270 CTTTGTAAGGTGAATGTTGATGG - Intronic
918444732 1:184605900-184605922 ATTTGGGATGGGCTTGTTGGGGG + Intronic
924066773 1:240231611-240231633 ATTTGTGAGGGGCTTGTAGTAGG + Intronic
924478635 1:244405493-244405515 TTTTGTAATGTGATTGCTGGTGG + Intergenic
1064376663 10:14802557-14802579 TTTTTTAAAGGGATTGTAGGGGG + Intergenic
1065424152 10:25581807-25581829 ATTTGCATGGGTATTGTTTGGGG - Intronic
1065805357 10:29389057-29389079 ATTAGTATGGCTATTGTTGGTGG - Intergenic
1069936643 10:71921997-71922019 ATTTGGCAGGGGGTTGTGGGTGG + Intergenic
1070492457 10:76990518-76990540 ATTTGCAAGGGGCTGGTTGCTGG - Intronic
1070861426 10:79667760-79667782 ATTTCTCAAGGGATTGTTGTGGG + Intergenic
1070941342 10:80350868-80350890 ATTGGTAAGGGAATTGTTGAAGG - Intronic
1071132967 10:82417111-82417133 ATTTGTAAGTGGATTTTTTGTGG - Intronic
1072160947 10:92765904-92765926 ATCTGTGAGGGAATTGCTGGAGG + Intergenic
1073885291 10:108032536-108032558 TTTTGTAAGGGATTTATTGGAGG + Intergenic
1074972923 10:118556172-118556194 ATTTTTAAGGGTATTTTTGCTGG + Intergenic
1075358478 10:121806458-121806480 ATTTGTTATGGGTTTTTTGGGGG - Intronic
1075822692 10:125328339-125328361 ATTTATAAAGGGATTTATGGGGG - Intergenic
1075906274 10:126084415-126084437 ATTTGTGTGGGGGTTGTTGGAGG + Intronic
1075957662 10:126537860-126537882 ATTTGAAAGAGGATTGTTGCAGG + Intronic
1078124366 11:8545564-8545586 ATTTGTAAGTTAATTGTTGGTGG - Intronic
1078703297 11:13711959-13711981 ATCTGCAAGGGCATTGTTGGAGG - Exonic
1081340404 11:41920600-41920622 ATCTGTAAGGGGATTTTTCCAGG + Intergenic
1082154533 11:48789796-48789818 ATCTGCAAGGGGATATTTGGAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082305969 11:50575586-50575608 ATTTGTGAAGGGATATTTGGGGG - Intergenic
1082577211 11:54822447-54822469 ATTTGTGAAGGGAGAGTTGGGGG + Intergenic
1086507489 11:87520971-87520993 TTTTGTGAGGGTTTTGTTGGTGG - Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087014745 11:93543708-93543730 ATCGGAAAGGGGATAGTTGGAGG + Intergenic
1087123913 11:94604389-94604411 ATATTTCAGGGGATTCTTGGAGG + Intronic
1087221121 11:95547326-95547348 ATTTGTAAGAGACTTGTTGTGGG + Intergenic
1087915228 11:103802525-103802547 ATTTCTGAGGGGAGTGGTGGTGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089436458 11:118472918-118472940 GATGCTAAGGGGATTGTTGGAGG - Exonic
1091532146 12:1368967-1368989 ATCTGTTAGGGGATTTTTAGAGG + Intronic
1092488713 12:8925557-8925579 ATGTGGAAGGAGAGTGTTGGAGG + Intronic
1093757669 12:22870634-22870656 ATTTGGAAGGGGCTTACTGGTGG - Intergenic
1094878374 12:34679527-34679549 ATTTGCAAGTGGATATTTGGAGG + Intergenic
1095070442 12:37837243-37837265 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1096695640 12:53346432-53346454 AATTGGAATGGGATGGTTGGTGG - Intergenic
1096891544 12:54776651-54776673 ATTTGAAAAAGGATTGTTTGAGG + Intergenic
1097277848 12:57825332-57825354 ATGAGGAAGGGGCTTGTTGGAGG - Intronic
1098670661 12:73225915-73225937 ATGTGTGGGGGGAGTGTTGGGGG + Intergenic
1099278973 12:80618039-80618061 ATGTGTAAGAGGTTTTTTGGGGG - Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1100979669 12:100154567-100154589 CTTTGGATGGGGATTGTTGGGGG - Intergenic
1101770013 12:107740860-107740882 CTTTGTAGAGGGATTGTAGGTGG - Intronic
1102694353 12:114786530-114786552 AATAGTAATGGGTTTGTTGGAGG + Intergenic
1103147777 12:118610430-118610452 ATTTTTAAGGGTATTGGTGTGGG + Intergenic
1104746112 12:131211399-131211421 ATTGGTTAGGGGATGGTGGGGGG + Intergenic
1105075067 13:16005714-16005736 ATCTGTAAGTGGATATTTGGAGG + Intergenic
1105075365 13:16011351-16011373 ATCTGTAAGTGGATATTTGGAGG + Intergenic
1105075672 13:16016990-16017012 ATCTGTAAGTGGATATTTGGAGG + Intergenic
1106607124 13:31239113-31239135 ATTTGTAAGGGAACAGTTTGTGG + Intronic
1106722092 13:32445636-32445658 ATGTGTAAAGGCATTTTTGGTGG + Intronic
1107694335 13:42985881-42985903 GTTTTTAAGGGGATTCATGGAGG - Intronic
1108446652 13:50515822-50515844 ATTAGTAAAGGGATTTTGGGAGG - Intronic
1113418967 13:110155136-110155158 CTTTGGAAGGGGATGGTTGGAGG + Intronic
1114222061 14:20705500-20705522 ATTTGCAAGTTGATTTTTGGGGG - Intergenic
1114326662 14:21595744-21595766 ATTTGTGAGGGAATTGTTTTTGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1118135415 14:63020626-63020648 ATTTCTAAAGGGAATGGTGGAGG + Intronic
1118360200 14:65049885-65049907 ATGTGTATGGGGATTTTTGGGGG - Intronic
1118513395 14:66501332-66501354 ATTTGTAAATGTATTGCTGGTGG - Intergenic
1120974414 14:90236099-90236121 ATGGGTAAGGGGCTTTTTGGAGG - Intergenic
1123225492 15:17020742-17020764 ATGTGAAAGTGGATAGTTGGAGG + Intergenic
1124573503 15:30886728-30886750 ATTTCTAAGGGAAGTGTTAGTGG - Intergenic
1125106212 15:35974451-35974473 CTTTGTATGGGGATTGTTTTTGG - Intergenic
1127635484 15:60865487-60865509 ATTGGTAATGGGATTGCTGATGG + Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1133948924 16:10373463-10373485 ATGTGTCAGTGGATTTTTGGGGG + Intronic
1134283661 16:12840864-12840886 ATTTGTAATTGGATTTTTTGGGG - Intergenic
1136714847 16:32270086-32270108 ATTAGTAAAGTGATTTTTGGTGG - Intergenic
1136753071 16:32659650-32659672 ATTAGTAAAGTGATTTTTGGTGG + Intergenic
1136815042 16:33210714-33210736 ATTAGTAAAGTGATTTTTGGTGG - Intronic
1136821518 16:33320794-33320816 ATTAGTAAAGTGATTTTTGGTGG - Intergenic
1136828081 16:33377333-33377355 ATTAGTAAAGTGATTTTTGGTGG - Intergenic
1136833147 16:33476104-33476126 ATTAGTAAAGTGATTTTTGGTGG - Intergenic
1136907481 16:34112766-34112788 ATTTGCAAGAGGATATTTGGAGG + Intergenic
1136916790 16:34211382-34211404 ATCTGCAAGGGGATATTTGGAGG - Intergenic
1139299381 16:65932102-65932124 ATTTATAAAGGGTTTGGTGGGGG + Intergenic
1141045804 16:80715356-80715378 ATTAGTTGGGGTATTGTTGGTGG - Intronic
1202993619 16_KI270728v1_random:33689-33711 ATTAGTAAAGTGATTTTTGGTGG - Intergenic
1203055206 16_KI270728v1_random:919683-919705 ATTAGTAAAGTGATTTTTGGTGG + Intergenic
1142771214 17:2098371-2098393 ATGTGAAAGGGAATAGTTGGTGG - Intronic
1144050634 17:11494708-11494730 TTTTGGAAGGAAATTGTTGGAGG + Intronic
1148115283 17:45171738-45171760 ACGTGTAAGGGGGATGTTGGAGG - Intergenic
1150108889 17:62480116-62480138 ACTTGTAAGGGGGTTGTTACTGG + Intronic
1150132174 17:62675159-62675181 ATTTGTGTGGGGAGTGTTGAGGG + Intronic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1153298809 18:3574631-3574653 ATTTGGAAAGAGATTTTTGGAGG - Intronic
1153862544 18:9227950-9227972 AATGGGAAGGGGATTGGTGGGGG - Intronic
1154982239 18:21512546-21512568 ATTCTAAAGGGGATTTTTGGTGG + Intronic
1156765162 18:40644333-40644355 ATTTGTTAGGGGAGTGATGGAGG + Intergenic
1157168220 18:45377987-45378009 TTTTTTATGGTGATTGTTGGGGG - Intronic
1157304686 18:46508322-46508344 ATTAGAAAGGGGATTGTTATAGG + Intronic
1158722612 18:59938909-59938931 ATTCGTAGGGGCATAGTTGGAGG - Intergenic
1162219592 19:9164844-9164866 ATTTGAAAGGGGATTTGGGGAGG + Intergenic
1163394340 19:17050443-17050465 ATTTTTAATGGGAGTTTTGGAGG - Intronic
927082830 2:19647564-19647586 ATTGTTAAGGTGATTGTTGCAGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
931717343 2:65039556-65039578 GTTAGTAAGTGGACTGTTGGCGG + Intergenic
932788839 2:74634252-74634274 ATTTGTAATGAGAAGGTTGGTGG + Intronic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
940171943 2:150838201-150838223 CTTTTTAATGGGATTGTTTGGGG + Intergenic
943294298 2:186117377-186117399 ATTTTTAAGGGGATTTGTGGAGG - Intergenic
943996115 2:194767683-194767705 ATAAGAAATGGGATTGTTGGTGG + Intergenic
946517590 2:220430040-220430062 ATTTATAAGGTGTTTGTAGGGGG + Intergenic
947617371 2:231567027-231567049 ATTTGTAAGGATATCCTTGGTGG - Intergenic
1170545497 20:17432676-17432698 ATTTGGAAGGTCATTGTTTGTGG - Intronic
1170816247 20:19716951-19716973 GTTAGTAAAGGGATTTTTGGAGG - Intronic
1171735896 20:28783719-28783741 ATTTGCAAGTGGATATTTGGAGG - Intergenic
1171761704 20:29206852-29206874 ATCTGTAAGGGGATATTTGGAGG + Intergenic
1171761721 20:29207023-29207045 ATCTGAAAGGGGATATTTGGAGG + Intergenic
1171821761 20:29853318-29853340 ATCTGGAAGTGGATAGTTGGAGG + Intergenic
1171824819 20:29885946-29885968 ATTTGCAAGTGGATACTTGGAGG - Intergenic
1173972615 20:47164329-47164351 ATTTGTAAGGGGATTGTTGGGGG - Intronic
1177908513 21:27000832-27000854 ACTTGAAAGGGGATGGTGGGAGG + Intergenic
1178538874 21:33432842-33432864 ATCTGTAATGGGATGCTTGGTGG - Exonic
1180395857 22:12336718-12336740 ATCTGCAAGGGGATATTTGGAGG - Intergenic
1180398676 22:12386544-12386566 ATTTGCAAGTGGATATTTGGAGG + Intergenic
1180403891 22:12528046-12528068 ATCTGCAAGGGGATATTTGGAGG + Intergenic
1181513095 22:23397536-23397558 ATCCGTAAGGGGACCGTTGGGGG + Intergenic
951906785 3:27714578-27714600 AGATGTAAGGGGGCTGTTGGGGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
953556166 3:43948511-43948533 ATTGGAAAGGGCATTGTTTGGGG + Intergenic
956120528 3:65961506-65961528 ATTTTTCAGTGGATTTTTGGGGG - Intronic
956642302 3:71426692-71426714 ATTTTTAAGTGAAGTGTTGGAGG - Intronic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958408301 3:93777576-93777598 ATCCGTAAGGGGATATTTGGAGG - Intergenic
958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG + Intergenic
959332620 3:105024864-105024886 ATTTGTAAGAGGACTGCTAGTGG - Intergenic
959563454 3:107809434-107809456 ATTTGTAAAGGGGATGTTGCGGG + Intronic
959928117 3:111947885-111947907 ATTTGTAAAAGGATTGATGGAGG + Intronic
962066790 3:131989969-131989991 ATTTGGAAGGGGAATGTTGCTGG + Intronic
962178925 3:133185014-133185036 ATTTGTAAAGGGATGTTTAGTGG + Intronic
962282245 3:134060750-134060772 ATTTTTAAGGGGAGTGTATGTGG + Intergenic
963339214 3:144014276-144014298 AGTTCTAAGGGATTTGTTGGGGG + Intronic
964649249 3:158992400-158992422 AGTTATAAGGGGATAGTGGGGGG - Intronic
965782653 3:172304181-172304203 ATTTTTAGTGGGATTCTTGGAGG - Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
971272333 4:25161567-25161589 TTTTTTAAGGGGATTTGTGGAGG - Intronic
972487075 4:39552300-39552322 ATTTGGGATGGGATGGTTGGGGG - Intronic
973567945 4:52207375-52207397 CTTTGTAATGGGATTGTTTGTGG - Intergenic
974266775 4:59595952-59595974 ATTTGTGAAGGGCTTGTTGGAGG - Intergenic
976408966 4:84691107-84691129 ATTTGGGAAGGGACTGTTGGAGG + Intronic
977003760 4:91538625-91538647 GTTTGTATAGGGATTGTTTGGGG - Intronic
978971373 4:114810944-114810966 ATTTTTAATGGGATTATTTGTGG - Intergenic
980437437 4:132795970-132795992 ATTTGTAATGAGATTATTAGGGG - Intergenic
981099405 4:140813778-140813800 AGTTGAAGGGGGATTGTTGTGGG + Intergenic
982402800 4:154986464-154986486 ATATGTGAGGGGATTTTTAGGGG - Intergenic
983370724 4:166854661-166854683 AGTAGGAAGGGGATTTTTGGAGG + Intronic
983655841 4:170083551-170083573 ATTTTTAATGGGATTATTTGGGG - Intronic
987351866 5:17029537-17029559 CTTTTTAATGGGATTGTTGGGGG - Intergenic
987594486 5:19979186-19979208 AGTCATAAGGTGATTGTTGGTGG + Intronic
988390783 5:30627138-30627160 ATGTGTAAGAGGAGTGTTGGGGG - Intergenic
989511243 5:42289942-42289964 ATTTGCAAGGGTATAGCTGGGGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991080676 5:62595721-62595743 ATTTGTTGGGGTTTTGTTGGTGG + Intronic
991477501 5:67038465-67038487 AACTGTTAGGGGATTTTTGGTGG + Intronic
992209342 5:74462700-74462722 TTTTTAAAGGGTATTGTTGGTGG - Intergenic
992383134 5:76258152-76258174 GTGTGTAAGGAGTTTGTTGGAGG + Intronic
993092442 5:83442580-83442602 TTTTTTGAGGGGGTTGTTGGAGG + Intergenic
993266832 5:85737298-85737320 ATTGGTAAGGGTATTGGTGGGGG - Intergenic
995759575 5:115549307-115549329 ATTTTTAAGGGGTCTGTAGGGGG + Intergenic
998424000 5:142012129-142012151 CTTGGGAAGGGGATTGTTGCTGG - Exonic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1001697330 5:173681219-173681241 ATTTGTAATTGGGTTGTTTGAGG - Intergenic
1004634336 6:17452594-17452616 ATTTATTTGGGGATGGTTGGAGG - Intronic
1004997165 6:21204831-21204853 ATTTGTAAGTGTATAGTTAGTGG + Intronic
1005196928 6:23298079-23298101 CTTTGTAATGGGCTTATTGGGGG + Intergenic
1006808931 6:36807378-36807400 ACATGTTATGGGATTGTTGGAGG + Intronic
1007725142 6:43911525-43911547 ATGTGTCTGGGGAGTGTTGGGGG - Intergenic
1009012475 6:57858952-57858974 ATTTATAAGTGTATTGTAGGTGG + Intergenic
1009252866 6:61329812-61329834 ATTTGCAAGGGGATATTTGGAGG + Intergenic
1009253371 6:61340732-61340754 ATTTGCATGGGGATATTTGGAGG + Intergenic
1009253965 6:61351933-61351955 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1009253996 6:61352276-61352298 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1009257552 6:61431633-61431655 ATTTGCAAGGGGATATTTGGAGG + Intergenic
1009258057 6:61442553-61442575 ATTTGCATGGGGATATTTGGAGG + Intergenic
1009258651 6:61453754-61453776 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1009258682 6:61454097-61454119 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1010744352 6:79544029-79544051 GTTTGAAAGAGGATTCTTGGGGG - Intergenic
1011138292 6:84123875-84123897 GTTTGTAACGGGATTGTTTGGGG - Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1011915321 6:92497864-92497886 ATTTTTAATGAGATTGTTGCAGG + Intergenic
1013303163 6:108822995-108823017 TTTTCTAAGGTCATTGTTGGTGG - Intergenic
1013434703 6:110091388-110091410 ATGTGTAAGAGAATTATTGGAGG - Intergenic
1015239238 6:131005504-131005526 AGTGGAAAGGGGAGTGTTGGGGG + Intronic
1017334360 6:153237789-153237811 ATTTGTAACTGGTTTGTTAGGGG + Intergenic
1021157214 7:17225409-17225431 GGTTGTCAGGGGATGGTTGGGGG - Intergenic
1022192422 7:28029422-28029444 ATTTGAGAGGGGATTTTTAGAGG - Intronic
1023784849 7:43695876-43695898 ATTTGTAAGGGAGTTGCTGTAGG - Intronic
1024682011 7:51700410-51700432 CTTTTTAAGGGGGTAGTTGGGGG - Intergenic
1024977545 7:55127665-55127687 CTTTATAAGGGGGGTGTTGGCGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1030123054 7:106129438-106129460 ATTAGCAAGGGGACAGTTGGTGG + Intergenic
1031455268 7:121971428-121971450 ATTTTTATGGGGAGTGTTGAGGG + Intronic
1032037904 7:128532638-128532660 ACTTGTAAGGGGGTTGTTACTGG + Intergenic
1032116350 7:129121021-129121043 ATCTATAATGGGATGGTTGGGGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1033998954 7:147387835-147387857 ATTTTTAAGGAGATAGTTTGAGG + Intronic
1035141356 7:156765766-156765788 ATTTCTTAGGGGCTGGTTGGAGG - Intronic
1036186458 8:6626650-6626672 ATATGTCATGGGAGTGTTGGGGG - Intronic
1038437546 8:27546561-27546583 ATTTGTAAGGGAGCAGTTGGGGG + Intergenic
1040142788 8:43945000-43945022 ATCTGCAAGTGGATTTTTGGAGG + Intergenic
1040271452 8:45951197-45951219 ATCTGCAAGTGGATTTTTGGAGG + Intergenic
1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG + Intergenic
1042026951 8:64433889-64433911 ATTTACAAGGGCATTGTTGAGGG + Intergenic
1044233623 8:89806537-89806559 ATTTGTCAGGGGAGTTGTGGGGG - Intergenic
1045032261 8:98148342-98148364 ATTGTTAAGGGGAATGTAGGGGG - Intronic
1046192340 8:110812805-110812827 ATTTAAAAGGGAATTGTTGATGG - Intergenic
1047177719 8:122557363-122557385 ATCAGGAAGGGGACTGTTGGTGG + Intergenic
1048582592 8:135742522-135742544 ATGTGCATGGGGATTGGTGGGGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053040800 9:34869583-34869605 ATTTGTAAGGGTAAAGTGGGAGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054424625 9:65048284-65048306 ATGTGTAAGTGGAATCTTGGAGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1056060058 9:82876097-82876119 ATGTGTAATGGGCTTATTGGAGG + Intergenic
1056606848 9:88093025-88093047 GTTTTTAAGGGGATTTGTGGAGG - Intergenic
1057809163 9:98244344-98244366 ATTTTTAAGGGGTTTGCAGGAGG - Intronic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1059966546 9:119620231-119620253 ATTTTTAATGGGGTTGTTTGGGG + Intergenic
1060130563 9:121093838-121093860 ATTTGCAAGGGCATTGGGGGAGG + Intronic
1061717625 9:132530580-132530602 TTTTCTAATGGGATTGTTTGGGG + Intronic
1203357459 Un_KI270442v1:171452-171474 ATTTGGAAGTGGATATTTGGAGG + Intergenic
1203404376 Un_KI270515v1:3596-3618 ATTTGGAAGTGGATATTTGGAGG + Intergenic
1203399189 Un_KI270519v1:67045-67067 ATCTGTAAGTGGATATTTGGAGG + Intergenic
1186614652 X:11173957-11173979 ATTTGTTAGGGTGTTGTTTGGGG - Intronic
1186745500 X:12563874-12563896 ATCTTTAAGATGATTGTTGGAGG + Intronic
1187172244 X:16863440-16863462 ATGAGTGTGGGGATTGTTGGTGG - Intronic
1187999498 X:24967343-24967365 ATTTGTATGCTGATTGTTTGAGG + Intronic
1189692939 X:43635874-43635896 ATTTACAAGGGGATTCTTGATGG - Intergenic
1190297669 X:49038152-49038174 ATTTGGGAGGGGAATGTGGGAGG + Intronic
1191274276 X:58520396-58520418 ATTTGCAAGTGGATATTTGGAGG + Intergenic
1194619641 X:96154254-96154276 ATATATAAGGGGATTGCTGAAGG + Intergenic
1195448819 X:104985941-104985963 ATTTGTAAGACTAGTGTTGGGGG - Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195825913 X:109000514-109000536 ATTTTTAAAGGGATTCTAGGTGG - Intergenic
1195942120 X:110175316-110175338 AGTTGGAAGGGGATTGTGGGAGG + Exonic
1197477876 X:126945902-126945924 ATTCCTAAGGTGTTTGTTGGTGG + Intergenic
1198778699 X:140210285-140210307 ATTTGTAATTTGAATGTTGGAGG + Intergenic
1199541012 X:148958002-148958024 ATTTGTGGGGGCATTGTTGATGG + Intronic
1199754101 X:150848490-150848512 ATTTCTAAGTGTATTGTTAGTGG - Intronic
1200857762 Y:7958021-7958043 CATTGTAAAGGGATTGGTGGGGG + Intergenic
1201079882 Y:10231025-10231047 ATCTGTAAGTGGATATTTGGAGG - Intergenic