ID: 1173972832

View in Genome Browser
Species Human (GRCh38)
Location 20:47165739-47165761
Sequence CCCTCTCCAGCCCCTTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173972832 Original CRISPR CCCTCTCCAGCCCCTTGAAA GGG (reversed) Intronic
900829975 1:4959027-4959049 CCCTCACCAGCACCTTCCAAGGG - Intergenic
901165932 1:7221595-7221617 ACCTCTCCAGGCCCGTGGAATGG + Intronic
901173141 1:7278966-7278988 CCCTCCCCAGCCCCATTAACTGG - Intronic
901528174 1:9836967-9836989 CCCTCTGCAGAGCCTTGCAACGG - Intergenic
902993804 1:20208383-20208405 GCCTCTGAAGCCCTTTGAAATGG + Intergenic
903183901 1:21618978-21619000 CCCCCTCCACCCCCTAGAGAGGG + Intronic
903594571 1:24484343-24484365 CCCTCAGCAGCCCCTGGAAATGG + Intergenic
903601110 1:24541492-24541514 CTTCCCCCAGCCCCTTGAAAAGG - Intergenic
905028194 1:34865521-34865543 CCCTCCCCAGCCGCTGGGAAAGG + Exonic
906846426 1:49197780-49197802 CCTTCTCTAGTCCCATGAAAGGG + Intronic
909068129 1:70960998-70961020 CCCACTCCAGACCTATGAAATGG - Intronic
910833976 1:91488847-91488869 CTCTCTCTAGCCACATGAAAAGG - Intergenic
912263147 1:108129233-108129255 TCCTCCCCAGGCCATTGAAAAGG + Intergenic
913020313 1:114782736-114782758 ACACCTCCAGCTCCTTGAAAAGG - Intergenic
915457599 1:156051139-156051161 CCCTCCCCAGCCCCCGGAGAGGG + Exonic
915695616 1:157738895-157738917 GCCTCTCCAGCCACGTGGAACGG - Intergenic
915973368 1:160369107-160369129 CTCCCTCCAGCCCCTGGCAACGG + Intronic
916780507 1:168022623-168022645 CCCTCTCCAGCTCCTTAAGATGG - Intronic
917178708 1:172268231-172268253 TCCTATCCAGCCCCTTAACAGGG - Intronic
917971271 1:180209417-180209439 GCCTCTCCAGCCATGTGAAATGG + Intergenic
918066821 1:181106844-181106866 CCCCCTCCAGCCTCTGGCAAGGG - Intergenic
918659866 1:187074510-187074532 CCCTCACCAGCAGCTTGAATAGG - Intergenic
920038594 1:203081816-203081838 TCCTCTCCAGCCCCTCCAAGGGG + Intergenic
921030432 1:211331229-211331251 CCCTCTGCAGCAGCATGAAAAGG - Intronic
921044494 1:211464871-211464893 CTCTCTCAGACCCCTTGAAAGGG + Intergenic
923265966 1:232314478-232314500 CCCTCCCCAGCCACTTAAACAGG + Intergenic
923507890 1:234622016-234622038 CCCTCCCCACCTCCTTGAAACGG + Intergenic
924643429 1:245855309-245855331 CCCCCCCCAGCCCCTAAAAACGG - Intronic
924798160 1:247308092-247308114 CCCTCCCCGGCCCCTGGGAAAGG + Intronic
924936402 1:248775570-248775592 CTATCTCCAACCACTTGAAAAGG + Intergenic
1063608517 10:7543594-7543616 CCGTCTGCAGACCCTGGAAAGGG + Intergenic
1066206190 10:33191437-33191459 CTCTCTCCCGACCCTTGAAGGGG - Intronic
1067205023 10:44205576-44205598 CCCTCTTCATTCCCTTGAAATGG + Intergenic
1067563105 10:47317675-47317697 CCCTCTGCAGCTCCATGGAAAGG + Intergenic
1067793507 10:49304730-49304752 CTTTCTCCAGCCCCTGGGAAGGG - Intronic
1069599422 10:69693858-69693880 CCCTCTCCAGCCACTTCTTAGGG + Intergenic
1070800141 10:79240320-79240342 CCCGCTCCACCCCCTTGATAAGG - Intronic
1070855176 10:79603004-79603026 CACTCTGCACCCCTTTGAAACGG + Intergenic
1071377813 10:85028147-85028169 CCACCTTCAGTCCCTTGAAAAGG + Intergenic
1071461672 10:85902849-85902871 ACCTCTCCTTCCCTTTGAAATGG + Intronic
1075295289 10:121269913-121269935 GCCTCCCCAGCTCCTTCAAAGGG - Intergenic
1076626595 10:131824779-131824801 TCCTCACCAGCCCCGTGAAGAGG - Intergenic
1077248248 11:1549373-1549395 CCCACTCCTGCCCCTGGGAATGG - Intergenic
1077872411 11:6273087-6273109 CCCTGACCAGGGCCTTGAAAGGG + Intergenic
1080257857 11:30312425-30312447 ACCTCTTCAGCCCCTTATAAGGG + Intergenic
1080709320 11:34731614-34731636 TCCTCTCCAGTCCCTAGAGAGGG - Intergenic
1081080581 11:38734614-38734636 GCCTCTCCAGCCATGTGAAATGG - Intergenic
1081122270 11:39282312-39282334 CTACCTCCAGCCCCTTGAAAGGG + Intergenic
1081814631 11:45931698-45931720 CCCACTCCAGGCCCTGGGAATGG - Intronic
1083460379 11:62807136-62807158 CCCTCTCCAGCCTCTCCCAAAGG - Exonic
1084444996 11:69198425-69198447 CCCTCTCCAGCCCAGAGCAAAGG - Intergenic
1084479270 11:69409242-69409264 CCCTCTCCTGCCCCTCCACAAGG - Intergenic
1084767062 11:71319093-71319115 CCCTCCTCAGCCTCTTGAAGTGG + Intergenic
1084937650 11:72595614-72595636 TCCTCTCCAGCTCATTAAAATGG - Intronic
1085342396 11:75741639-75741661 CCCTCTCCAGCCCTTTTCCAGGG - Intergenic
1087060987 11:93977334-93977356 CACACTCCAACCCCTGGAAAGGG - Intergenic
1087901612 11:103647866-103647888 CTTTTTCTAGCCCCTTGAAATGG - Intergenic
1088765314 11:112969819-112969841 TCCTCTCCAACCACCTGAAAGGG - Intronic
1088923931 11:114281707-114281729 CCCTCTTCAGCCAGTTGAAAGGG + Intronic
1089603253 11:119627612-119627634 CCCTCCCCAGCCCCTGTGAAAGG - Intronic
1091291940 11:134445458-134445480 CCCTCTCCAGCACCTGCACATGG - Intergenic
1091596183 12:1880520-1880542 GCTCCTCCAGCCACTTGAAAGGG + Intronic
1092026673 12:5246538-5246560 CCCTTCCCAGCCCCTTCAGAGGG - Intergenic
1092197333 12:6557178-6557200 CCATCATCAGCCCCTTGGAAGGG - Exonic
1095985273 12:47995196-47995218 CCCTCTCCAGGCCCTTTCAAAGG + Intronic
1096180111 12:49546057-49546079 TCCACTCCCGCCCCCTGAAATGG + Intronic
1096498148 12:52050567-52050589 CCCTCCCCAGCCCCTTACAGGGG - Intronic
1096534478 12:52262511-52262533 CACTCTCCAGTCTCTTGCAAAGG - Intronic
1097231973 12:57518200-57518222 CCCTCTTCTGCCCTTCGAAATGG - Intronic
1099927211 12:89032690-89032712 CCCTCTTCAGCTTCTTGTAATGG - Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1103164137 12:118755750-118755772 GCATCTCCAGCCCCTTGAATGGG - Intergenic
1103831547 12:123783653-123783675 AGCTCTCCAGCCCCTAGAAAGGG - Intronic
1103914768 12:124370498-124370520 CCCTCCCAAGTCCCTTGGAATGG - Intronic
1104601223 12:130154786-130154808 CCCTCCCCAGCCCCTTGTCTCGG - Intergenic
1105304519 13:19159363-19159385 ACCTCTCCAGCTCATTGGAAGGG + Intergenic
1106626359 13:31424804-31424826 CCCTCTCTAACCCTTTCAAAGGG + Intergenic
1108945037 13:56011615-56011637 CCCTCTCCATCTCCCTGAAAGGG - Intergenic
1112003731 13:95236164-95236186 CCCTCTCGAACCCGTTGTAAGGG + Intronic
1112880493 13:104101132-104101154 CACTGTCCAGCCTCCTGAAAGGG + Intergenic
1114365985 14:22027433-22027455 CTCTCTCCTTCCCCTTGAAGAGG + Intergenic
1117272555 14:54159697-54159719 CCTTCTCCAGGACCTTGAAGGGG - Intergenic
1117489045 14:56227754-56227776 CCCTCCCCAGACCCTGGAATTGG - Intronic
1118485210 14:66208109-66208131 CCCTCTCCAGCCCCTCCTAAGGG + Intergenic
1118612966 14:67555687-67555709 CACTCTCGAGCCACTTGAGATGG + Intronic
1119443949 14:74648195-74648217 CCCTCTCCAGCACCAGGAAGAGG + Intergenic
1121255024 14:92524907-92524929 CCCTCTCTAGCCTCTGGAAGGGG + Intronic
1122776419 14:104118834-104118856 CCCTCAGCAGCCCCGTGAGAGGG + Intergenic
1123126879 14:105953102-105953124 CTCCCTCTAGACCCTTGAAAGGG - Intergenic
1124836699 15:33202455-33202477 CCATCCCCAGTGCCTTGAAAAGG - Intergenic
1125880905 15:43194540-43194562 CCCTTTCCCACTCCTTGAAATGG - Intronic
1127655733 15:61053705-61053727 CTCCCTGTAGCCCCTTGAAAAGG - Intronic
1127999337 15:64176231-64176253 CTCTCTCCAGTCCATTGCAAGGG - Intronic
1129723716 15:77891258-77891280 CCCTCGCCAGCCCCTGCAGAAGG + Intergenic
1129828859 15:78653926-78653948 CCATCTCCAGCACCATGGAAGGG + Intronic
1130118215 15:81024128-81024150 TCCTCTCCAGCTCCTTTCAAGGG + Intronic
1130485875 15:84398272-84398294 CACTCTCCAGCCATTTGGAAAGG + Intergenic
1131897973 15:97054380-97054402 CCCTCTCCTCCCCCATGAAAAGG - Intergenic
1135092006 16:19524460-19524482 CCCTCTCCAGCACCGTGGGAGGG - Intronic
1135770777 16:25216904-25216926 GCCTCTGCAGCCCTTTAAAAGGG + Exonic
1136230689 16:28883648-28883670 ACCTCTCCAGCCCCCCGACAAGG + Intronic
1138191314 16:55016397-55016419 TCCTCTCCATCCCCAGGAAAGGG + Intergenic
1142026242 16:87815537-87815559 CCCTCTCCCTCCCCTTAAAAGGG - Intergenic
1142600704 17:1052323-1052345 CCCTCCCCAGCCCCTCGAGGAGG - Intronic
1143325647 17:6096469-6096491 CCCCCTCCAGCCCCCTCCAAGGG - Intronic
1143617823 17:8064187-8064209 CCCCCTCCAGCCACTGGTAAGGG - Intergenic
1143987386 17:10926577-10926599 GCCTCTCCTGCCCTTGGAAAGGG - Intergenic
1144764183 17:17723966-17723988 CTCTCGCCAGCCGCTTGCAACGG - Intronic
1146266320 17:31455361-31455383 CCCTCTCCCGTCCCATGAAAAGG - Intronic
1146280261 17:31540117-31540139 CCCTCTCTAGTACCCTGAAAGGG - Intergenic
1147244856 17:39113235-39113257 CCCTCTCAAGGCCCTGGGAAAGG - Intronic
1149447447 17:56724641-56724663 CTCTCTCCAGGCCCTGGTAATGG + Intergenic
1149632457 17:58137728-58137750 CCCTATCAAGCCCCTTTATAAGG - Intergenic
1151038081 17:70824050-70824072 CCCTTTCAAACCCTTTGAAAAGG + Intergenic
1151547104 17:74799859-74799881 CCCTCTGCACCCTCATGAAAAGG - Intronic
1152891160 17:82882380-82882402 CCCGCTCCAGGCCCTGGAGATGG - Intronic
1153834294 18:8950260-8950282 CCCTCCCCAGGCCTTGGAAAAGG + Intergenic
1155162305 18:23205980-23206002 CCCTCCCCAGTGCCTTCAAATGG + Intronic
1156216124 18:34999892-34999914 CCCTCTGCTGCCCCTAGAGAAGG + Intronic
1156336176 18:36173890-36173912 ACCTCCCCAGCCCTTTAAAAAGG - Intronic
1157495878 18:48157060-48157082 CCCTCTCCCACCCTTTGAAATGG - Intronic
1157714492 18:49874056-49874078 CCCTCTACAGCACCCTGAAATGG - Intronic
1159390642 18:67788417-67788439 ACCTCTCCAGCCCATTGCACAGG - Intergenic
1159715529 18:71817147-71817169 CGCCCTCAAGCCCCTTGAAAAGG - Intergenic
1161252868 19:3290412-3290434 CCCTCGCCTGCCCCCTGACAGGG + Intronic
1163720027 19:18894499-18894521 CCCTCCCCAGCCCCTTGGGTGGG - Intronic
1164134376 19:22400170-22400192 CTCTCTCCAGACCTCTGAAAGGG - Intronic
1164692390 19:30221276-30221298 CAGGCTCCAGCCCCTTGAGATGG - Intergenic
1165087992 19:33364622-33364644 CCTTCTCCAGCCCCTTGGCTTGG + Intergenic
1165159886 19:33809945-33809967 GCCTCTCCTGCCCCATGCAAGGG - Intronic
1165166209 19:33859010-33859032 CCCACTGCAGCCCCATAAAAGGG + Intergenic
1165339338 19:35199508-35199530 CCCTCTCCAAGCTCTAGAAATGG + Intergenic
1166430547 19:42722907-42722929 CCCTCTCCAGACCTTTAAACTGG + Intronic
1166469404 19:43065487-43065509 CCCTCTCCAGACCTTTGAACTGG + Intronic
1166480532 19:43169025-43169047 CCCTCTCCAGACCTTTAAACTGG + Intronic
1167414818 19:49364501-49364523 CCCTCTCCAGCACCTTGCCCAGG - Intronic
1168519510 19:57037356-57037378 CCCTGTCCTGCCCCTTGAGACGG + Intergenic
1168666637 19:58209666-58209688 CCCTCAGCAGCCCCCGGAAAGGG + Intronic
924976693 2:183752-183774 TTACCTCCAGCCCCTTGAAAGGG + Intergenic
928097589 2:28413916-28413938 CCTTCCCCAACCCCGTGAAAGGG - Exonic
928379059 2:30802602-30802624 CCCTCTCCAGCCCTAAGAAACGG + Intronic
929875179 2:45790984-45791006 GCGTCTCCAGACCTTTGAAAAGG + Intronic
931550861 2:63444589-63444611 CTCCCTCCAACCCCTTGCAATGG - Intronic
931550949 2:63445617-63445639 CTCCCTCCAACCCCTTGCAATGG - Intronic
934528496 2:95068652-95068674 GCCTCTCCAGACCCTTCCAATGG - Intergenic
935657118 2:105433088-105433110 CCCTTCCCAGCCTCTTGAGAAGG + Intronic
938138995 2:128781440-128781462 GCCTCTGCAGCACCTTGGAAGGG - Intergenic
938293293 2:130161608-130161630 GCCTCTCTAGCTCCTTGGAAGGG + Intronic
938463259 2:131511357-131511379 GCCTCTCTAGCTCCTTGGAAGGG - Intergenic
938912867 2:135901426-135901448 TACTCTCCAGCCCCTTAATAAGG - Intergenic
941282502 2:163570880-163570902 CTCTCTCAAGCCCTTTTAAAAGG - Intergenic
941682748 2:168416102-168416124 GCCTCCCCAGCCACATGAAACGG - Intergenic
943440424 2:187921324-187921346 CCACCTCAAGCTCCTTGAAAAGG + Intergenic
943727338 2:191265959-191265981 CCCTCTCCACCCCCTCAACATGG - Intronic
944573680 2:201071183-201071205 CCCTCACCACCCCCAGGAAATGG + Intronic
944663378 2:201939552-201939574 CTTTCTCCAGGGCCTTGAAAAGG - Intergenic
944928257 2:204488026-204488048 CGGACTCCAGCCCCTTGAAAGGG + Intergenic
945087359 2:206145730-206145752 TCCTCTCCACCCCCTCAAAATGG + Intronic
946037062 2:216752658-216752680 CCCTCTCCAGCCACTTGAGATGG + Intergenic
947781778 2:232772799-232772821 CCTTCTCAAGCCCCATTAAAAGG - Intronic
1168874097 20:1158624-1158646 CCCTTTCCAGTCCCTTAAAGAGG + Intronic
1169200222 20:3705658-3705680 CCCTCTCCAGCCCACAGAAACGG - Intronic
1169735876 20:8837116-8837138 CCCTCTCCAGCCTCTTCTAAGGG + Intronic
1170143967 20:13152803-13152825 CCCTGTTCAACCCTTTGAAAAGG + Intronic
1170541015 20:17388084-17388106 CCTTCTTCAGATCCTTGAAAGGG - Intronic
1172701557 20:36856408-36856430 CCCTCTGCAGCCCCCAGCAAGGG + Intronic
1172861821 20:38060324-38060346 CCCACTCCAGTCCCTTGACTTGG + Intronic
1173972832 20:47165739-47165761 CCCTCTCCAGCCCCTTGAAAGGG - Intronic
1174341536 20:49900099-49900121 TTCTCTTCAGCCCCTTGTAAGGG + Intergenic
1175879516 20:62249121-62249143 AACTCACCAGTCCCTTGAAAAGG - Intronic
1176127960 20:63484330-63484352 GCCTCTCCAGCTCCCTGAACAGG - Intergenic
1177381017 21:20344469-20344491 TACTCTCCAGCCCATTGTAAAGG + Intergenic
1178022666 21:28427918-28427940 CCCTCTCCAGTATCATGAAAGGG - Intergenic
1178321501 21:31609592-31609614 CCTTCTCCAGGCCCTTGAGCTGG - Intergenic
1178727235 21:35064817-35064839 ACTTCTCCAGGTCCTTGAAAAGG - Intronic
1180085375 21:45505743-45505765 CCCTGCCCAGCACCCTGAAACGG + Intronic
1181112653 22:20611047-20611069 GCCTCTCCAGCTCATTGGAAGGG + Intergenic
1182241188 22:28917724-28917746 CCCTCAGCTGCCCCTTGGAAAGG + Intronic
1182347645 22:29677870-29677892 GCATCTCCAGCCCCTTGCACAGG + Intronic
1182819650 22:33204191-33204213 CCCTCTCCAGCCCCTCAATTCGG - Intronic
1183025725 22:35064786-35064808 CCCTGTCCAGCCCTAGGAAAGGG + Intergenic
1183081317 22:35458492-35458514 CCCTCTCCAGCCCCCAGGAAGGG + Intergenic
1183718212 22:39546767-39546789 CCCTCTCCAGCCCCTTGTCATGG + Intergenic
1184038337 22:41928991-41929013 CCCTCTCCATCCCCTGTACATGG + Intergenic
1184413240 22:44337853-44337875 CCCCAGCCAGCCCTTTGAAAAGG - Intergenic
951128007 3:19006658-19006680 CCATCTCCAGCACCTATAAAAGG + Intergenic
952301735 3:32109450-32109472 CCCACTCCAGCCCAGGGAAATGG + Intronic
953440420 3:42911328-42911350 CCCACTCCAGCCCCCTACAAAGG + Intronic
953874783 3:46660527-46660549 CTCTCTGCCGCCCCTTAAAAGGG + Intergenic
955877567 3:63508804-63508826 CCCTCTTCATCCCTTAGAAAGGG + Intronic
956589897 3:70903687-70903709 CCCTTTCCAACCCCTGCAAAAGG + Intergenic
956611868 3:71132054-71132076 TTTTCTCCTGCCCCTTGAAAAGG - Intronic
956868989 3:73397871-73397893 CCATCTCTAGCCCCTTTGAATGG - Intronic
962418805 3:135208898-135208920 CCCTCTCCAGGCCTTGGAAGGGG - Intronic
963352138 3:144164738-144164760 CCCACTCAATCCCCTTGATATGG - Intergenic
963732538 3:148987218-148987240 CCCTCCCCAGTCCCTGGAGAGGG + Intergenic
963910687 3:150815184-150815206 CCATCTACAGCCCCTTGAAAAGG - Intergenic
964999504 3:162935250-162935272 TCCTCTTCAGACCCTTTAAAAGG - Intergenic
965410938 3:168330311-168330333 CCATCTCTAGCCCCTGGCAAGGG + Intergenic
966879668 3:184342947-184342969 CCCTCTCCCTCCCCTTGCAAAGG - Intronic
967891100 3:194365151-194365173 CCCTGTCCAGCTCCTGGGAAGGG + Intronic
968441813 4:628053-628075 CCATGCCCAGCCCCTTGGAATGG - Intronic
968592360 4:1465456-1465478 CCCTCTCCTGCCCCTTGCTCTGG - Intergenic
969649138 4:8453294-8453316 CTCCCTCCAGCTCCTTGAGATGG - Intronic
970945906 4:21691369-21691391 TCCTCTCCAGGCTCTGGAAATGG + Intronic
971750029 4:30635146-30635168 CCCTCACCAGGACCTTGGAAAGG + Intergenic
972684636 4:41340004-41340026 CCCCCTCCTGCCCCTGGAAGGGG - Intergenic
977154446 4:93555259-93555281 ACCTTTCCATCCCCTGGAAAGGG + Intronic
978367929 4:108002082-108002104 GTCTCTCAAGCCCCTTTAAATGG - Intronic
978747458 4:112209893-112209915 CCCTCTCCATCCCCTTTTGATGG - Intergenic
980322352 4:131294185-131294207 CCCTCAGCAGCTCCTAGAAAAGG - Intergenic
983461431 4:168029336-168029358 CCTTTTCCAGCCCCATGCAATGG + Intergenic
985910715 5:2878566-2878588 CCATTTCCAGCACCTTGAATTGG + Intergenic
986402559 5:7395342-7395364 TCCTCTCCACCCTCTTGAGAGGG - Intergenic
987025157 5:13919380-13919402 GCGTCTCCAGCCCCGTGCAATGG - Intronic
991493785 5:67208529-67208551 CCCCTTCCATCCCCTTGGAAGGG - Intergenic
993123850 5:83807727-83807749 CCCTCTCATGAGCCTTGAAATGG - Intergenic
994211201 5:97089183-97089205 ACCTCTCCAGCCACGTGAAACGG + Exonic
997595025 5:135101562-135101584 CTCTCTTCACCCCTTTGAAAGGG - Intronic
1001322969 5:170698108-170698130 CCCTCTCCAGGACCTAGAAGAGG + Intronic
1002435339 5:179227851-179227873 CCCTCTCCAGCCCCAAGCCAGGG - Intronic
1003087195 6:3069221-3069243 CCCTTACCAGCCCTTTGAAAGGG + Intronic
1005401275 6:25436832-25436854 CCCTCTCCACTCCACTGAAATGG - Intronic
1005740813 6:28788908-28788930 GGCTCTCCAGCCGCTTGAGATGG - Intergenic
1005881046 6:30061301-30061323 CTCTCACCGGCCCCTGGAAAGGG + Exonic
1006303733 6:33207292-33207314 CTCTCTCCAGCCCCTTTCATCGG - Intergenic
1006513284 6:34532985-34533007 TCCTCTCCAGACCCCTGGAAGGG + Exonic
1006600910 6:35225234-35225256 CCATCTCCTCCCCCTTAAAATGG - Intronic
1009730895 6:67604852-67604874 CTGTCCCGAGCCCCTTGAAAAGG - Intergenic
1013476340 6:110510693-110510715 CACTCTCCAACCTCTAGAAAGGG + Intergenic
1014270949 6:119335388-119335410 CCCTTTCCACGCCTTTGAAATGG - Intronic
1015736130 6:136402032-136402054 CCCTGTCCAACCCCTTGGACTGG + Intronic
1015847131 6:137532445-137532467 TACTCTCCAGCCCCAAGAAAGGG + Intergenic
1018080252 6:160253383-160253405 CAATCTCCAGCCCCTTTTAATGG - Intronic
1018780535 6:167059886-167059908 CCCCCTCCAACCTCTGGAAAAGG - Intergenic
1019192093 6:170257716-170257738 CCTTGTCCAGCCCCTGCAAAGGG + Intergenic
1019317744 7:397756-397778 ACCTTTCCAGCTCCCTGAAATGG - Intergenic
1022404810 7:30078873-30078895 CCCTCTCCAACCCCTTCACCTGG + Exonic
1023077802 7:36501170-36501192 CCCTCTCCATCCCCTTTTGATGG + Intergenic
1027517831 7:79164505-79164527 TCCTCTCCAGCCCTTTTTAAAGG - Intronic
1027655331 7:80923443-80923465 CCATCTACAGCCCTTCGAAATGG + Intergenic
1029022410 7:97378507-97378529 GTCTCTCCAGCACCTAGAAAAGG - Intergenic
1035948345 8:3990772-3990794 CCCTCTCCTTCCTCATGAAAGGG - Intronic
1038036667 8:23691816-23691838 CCTCCCCCAGCCCCTTGAGAGGG - Intergenic
1039705776 8:40005933-40005955 CTCCCTCCAGCCCCTTTATAAGG - Intronic
1040519368 8:48161827-48161849 TCCTCTCCCTCCCCTTGACAGGG + Intergenic
1042144254 8:65711839-65711861 CATTCTCCAGCCCCTTGTTAAGG + Intronic
1043077049 8:75715562-75715584 CCCTCTGCAGCCCAATGAATGGG - Intergenic
1047073732 8:121376572-121376594 CCTTCTCCTGCCTCTTCAAAGGG + Intergenic
1047440193 8:124870989-124871011 TCCAATCCAGCCCCATGAAATGG + Intergenic
1047752553 8:127892763-127892785 CCCTCAGCAGCCCCCCGAAATGG - Intergenic
1048189673 8:132276450-132276472 CCCTCCCCAGCCCCTGCAATGGG + Intronic
1048600717 8:135916290-135916312 CCCTCCCCCGCCCCCCGAAAGGG + Intergenic
1049243419 8:141549978-141550000 TCCTCTGCAGCCCCATGACATGG + Intergenic
1049386858 8:142347234-142347256 CCCTCTCCATCCCCTCCAGAGGG - Intronic
1051118838 9:13729453-13729475 CCCTGTCCAGCCCTTTTTAAGGG - Intergenic
1054872240 9:70058520-70058542 CCCTCACCAGGCCCTTGGGAGGG - Intronic
1054922255 9:70554280-70554302 TCCTCTCCAGCCCCCTATAATGG + Intronic
1055648285 9:78381436-78381458 CCTTCTCCAGCCCCATTCAAAGG - Intergenic
1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG + Intergenic
1057565955 9:96166554-96166576 ACCTCCCAAGCCCCTGGAAAGGG + Intergenic
1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG + Intronic
1058504320 9:105653251-105653273 CCCTATCCAGGCCCTGGAAAAGG - Intergenic
1058697171 9:107569333-107569355 GCCTCTCCTGCCCCGTGGAAAGG - Intergenic
1058866736 9:109167524-109167546 CCCACTCCAGACCCATGAAGCGG + Intergenic
1061009510 9:127946664-127946686 CTCTCTCCAGCCCCTGGATGGGG - Intronic
1062047845 9:134432647-134432669 CCCTATCCAGCAGCTTGAAGGGG - Intronic
1187192416 X:17047671-17047693 CCCACTTAAGCCCTTTGAAATGG - Intronic
1187972342 X:24671584-24671606 CCTTCTCATGCCCCTTGGAATGG - Intronic
1188818554 X:34745182-34745204 CCCACCCCAGCCCCCTGAAATGG - Intergenic
1193066366 X:77264759-77264781 CCAGCTCCAGCTCCTTAAAAGGG + Intergenic
1194908173 X:99605075-99605097 CCCTCTCCAGGCACTTCTAAAGG - Intergenic
1195667940 X:107447754-107447776 CCCTCTCCAGTCCCTGGAGATGG + Intergenic
1196498770 X:116352409-116352431 CCCTCTCTAGCTCCAGGAAAAGG - Intergenic
1197714439 X:129696204-129696226 CCCTCTGCTGCCCCCTGAGATGG - Intergenic
1198439995 X:136653830-136653852 ATCTCTTCAGCCCATTGAAAGGG + Intronic
1198460456 X:136858132-136858154 CGCCCTCCATCCCCCTGAAATGG + Intronic
1198920220 X:141717187-141717209 CTCTGTCAAGCCCCTTTAAAAGG + Intergenic