ID: 1173979287

View in Genome Browser
Species Human (GRCh38)
Location 20:47210778-47210800
Sequence CCTCCCGAAAGAGTCTCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173979287_1173979293 11 Left 1173979287 20:47210778-47210800 CCAGCCGAGACTCTTTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1173979293 20:47210812-47210834 GCTGGTACTGGTGTTGTGATCGG 0: 1
1: 0
2: 1
3: 9
4: 131
1173979287_1173979292 -1 Left 1173979287 20:47210778-47210800 CCAGCCGAGACTCTTTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1173979292 20:47210800-47210822 GAGGCTCTTCGTGCTGGTACTGG 0: 1
1: 0
2: 0
3: 9
4: 81
1173979287_1173979291 -7 Left 1173979287 20:47210778-47210800 CCAGCCGAGACTCTTTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1173979291 20:47210794-47210816 CGGGAGGAGGCTCTTCGTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173979287 Original CRISPR CCTCCCGAAAGAGTCTCGGC TGG (reversed) Exonic