ID: 1173980678

View in Genome Browser
Species Human (GRCh38)
Location 20:47221549-47221571
Sequence CTTGGGTGCCACTGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 218}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173980678_1173980694 17 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980694 20:47221589-47221611 GCATAAAAGTGGAGGCTCAAGGG 0: 1
1: 0
2: 2
3: 7
4: 115
1173980678_1173980696 19 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980696 20:47221591-47221613 ATAAAAGTGGAGGCTCAAGGGGG 0: 1
1: 0
2: 0
3: 19
4: 242
1173980678_1173980693 16 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980693 20:47221588-47221610 GGCATAAAAGTGGAGGCTCAAGG 0: 1
1: 0
2: 0
3: 15
4: 182
1173980678_1173980690 9 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980690 20:47221581-47221603 TACCCAGGGCATAAAAGTGGAGG 0: 1
1: 0
2: 3
3: 7
4: 115
1173980678_1173980684 -6 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980684 20:47221566-47221588 CCCAAGGCTCAGCCCTACCCAGG 0: 1
1: 0
2: 3
3: 33
4: 298
1173980678_1173980695 18 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980695 20:47221590-47221612 CATAAAAGTGGAGGCTCAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 151
1173980678_1173980686 -5 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980686 20:47221567-47221589 CCAAGGCTCAGCCCTACCCAGGG 0: 1
1: 1
2: 3
3: 21
4: 224
1173980678_1173980688 6 Left 1173980678 20:47221549-47221571 CCCTGCACCCAGTGGCACCCAAG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1173980688 20:47221578-47221600 CCCTACCCAGGGCATAAAAGTGG 0: 1
1: 0
2: 3
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173980678 Original CRISPR CTTGGGTGCCACTGGGTGCA GGG (reversed) Intronic
900602133 1:3507389-3507411 CTTGGGGGCCAGTGGCTGCAAGG - Intronic
901519201 1:9769624-9769646 GATGAGTGCCACTTGGTGCAAGG + Intronic
901678582 1:10900661-10900683 CTCAGGCTCCACTGGGTGCAGGG - Intergenic
902603175 1:17553840-17553862 CTTGAGTACCACTGGGTGCCAGG + Intronic
903189852 1:21650479-21650501 CCTTGGTGCCGCTGGGGGCAGGG + Intronic
906565586 1:46798952-46798974 CTTGGCTGCTGCTGGCTGCAGGG + Intronic
907048271 1:51313277-51313299 AGAGGGTGGCACTGGGTGCAGGG - Intronic
907404411 1:54245004-54245026 AGTCTGTGCCACTGGGTGCATGG - Intronic
908422522 1:63972980-63973002 CGTGGGCACCACTGGCTGCATGG - Intronic
909525245 1:76614909-76614931 CTAGGGTTCCAGGGGGTGCAGGG + Intronic
909975808 1:82045071-82045093 CTTAGCTGCCACTGGGTACTAGG + Intergenic
913529299 1:119722160-119722182 CCTGGCTGCCTCTGGGTCCAAGG - Intronic
914239964 1:145846665-145846687 CTTGGGTCCCTCTGGGTTTATGG + Exonic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915605150 1:156945729-156945751 CCTGGGTCCCTCTGGTTGCATGG - Intronic
920160835 1:203996652-203996674 CTTGGGTGCCACTTGGGAGAAGG + Intergenic
921846141 1:219884232-219884254 TTTGAGTGGCACTGCGTGCATGG - Intronic
922045859 1:221945852-221945874 CTGGGGTGGCACTGGTTACAGGG - Intergenic
923540488 1:234884999-234885021 CATGGGTGCCCCTGGGGGCCAGG - Intergenic
1064746024 10:18478852-18478874 CTTTGGTGCCTCTGGGTCCTGGG + Intronic
1067134116 10:43593264-43593286 GTTGGGTACCACTGGATGGATGG + Intergenic
1067176683 10:43954919-43954941 CTTGGGTGGGACTAGCTGCAAGG - Intergenic
1067528726 10:47055157-47055179 CTTGAGTGGTTCTGGGTGCAGGG + Intergenic
1067674002 10:48354072-48354094 CATGGGAGAAACTGGGTGCAGGG + Intronic
1070491461 10:76980754-76980776 CTTGAGTGTCACTGGTTCCAGGG - Intronic
1070598520 10:77849506-77849528 CCTGGCTGCCACAGGGAGCAGGG - Intronic
1071404676 10:85318496-85318518 CTTGTGTGTCCCTGAGTGCAAGG - Intergenic
1072048741 10:91682555-91682577 GTTGTATGCCACTGGGGGCAGGG + Intergenic
1072738204 10:97893634-97893656 ATTGGGTGAAACTGGGTGAAGGG - Intronic
1075230333 10:120671191-120671213 CCTGGGAGCCACAGGGAGCAAGG + Intergenic
1075941666 10:126395347-126395369 CTTGGGAGCGGATGGGTGCAGGG - Intergenic
1076789172 10:132767744-132767766 CTGGAATGCCACTGGGCGCATGG - Intronic
1077014104 11:392406-392428 CTGGGGTGGACCTGGGTGCAGGG + Intergenic
1077184115 11:1228826-1228848 CTTGGGGGCCACTGGGGGTGGGG + Intronic
1078043377 11:7890263-7890285 CTGGGGTTCCACGGGCTGCAGGG + Intergenic
1079393421 11:20041690-20041712 ATTGGGTGCCACTACGTGCCAGG - Intronic
1080130843 11:28792776-28792798 GTTGGGTGGCACGGGGAGCAAGG + Intergenic
1080188867 11:29522308-29522330 ATTAGGTACCACTGGGTGGATGG - Intergenic
1083812012 11:65111616-65111638 CCTGGGTGCCATGGGGTGCAGGG - Exonic
1083852990 11:65378718-65378740 CTGGGGTGTCAGTGGGTGCCGGG + Intronic
1084155905 11:67312326-67312348 TTTGGGGGCCACTGGTTGCCTGG - Exonic
1084784488 11:71434249-71434271 ATTGGGTGCCCGTGGGTGCGTGG - Intronic
1085201152 11:74703176-74703198 CATCGGTGCCACAGGATGCAGGG - Intronic
1089296561 11:117472420-117472442 CATGGGGGCCACTGGGTAAATGG - Intronic
1089485417 11:118841769-118841791 CTTGGCTGCCTCAGGGTGCAGGG + Intergenic
1091047240 11:132335446-132335468 CTTTGGTGCCAGTGTGGGCAAGG + Exonic
1091604505 12:1938379-1938401 CTTAGGTGCCACTGGCTCCCAGG - Intergenic
1096185625 12:49578727-49578749 CTTGGTTTCTACTGTGTGCATGG + Intronic
1097462082 12:59874190-59874212 CATGGCTGCTACTGGGGGCACGG - Intergenic
1099891046 12:88588581-88588603 CTGGAGTGGCACTGGGTACAAGG + Intergenic
1101615557 12:106333212-106333234 CTTGGGGGCAGCTGGGTGAAGGG + Intronic
1102582056 12:113895692-113895714 CTTGGGTGGCAGTGGATGAAAGG + Intronic
1103098546 12:118152184-118152206 GTCCGGTGCCACTGGGTGGAAGG - Intronic
1103135220 12:118501208-118501230 CTTGGCTGCCACTAAGTGCTGGG + Intergenic
1104979129 12:132565409-132565431 CCTGGGTGGCAGTGTGTGCATGG - Intronic
1105278853 13:18951641-18951663 CTTGGGTGCTGCTGGGTGGTGGG + Intergenic
1106808425 13:33334961-33334983 TTTGGGTGTCACTGGCTGGATGG + Intronic
1107566190 13:41607202-41607224 ATTGAGTGCCACTGTGTGCCAGG - Intronic
1111701812 13:91699310-91699332 CTTGGCTGCCACAAGGTGGAAGG + Intronic
1112367014 13:98763952-98763974 GTTGGGTACCACTGGATGGATGG - Intergenic
1112391788 13:98991921-98991943 CTGTGGGGCCACTGGATGCAGGG + Intronic
1112406364 13:99124048-99124070 CTTGGATTCCACTGGATTCAAGG + Intergenic
1115405212 14:33007239-33007261 CCTGGATGCCACAAGGTGCAGGG + Intronic
1118427927 14:65687709-65687731 CATGGCTGGCACTTGGTGCAGGG - Intronic
1121417201 14:93787846-93787868 CTAGGGTGCCCCTGGGTGCGGGG - Intronic
1122421315 14:101579273-101579295 TGTGGGTGACACTGAGTGCAAGG - Intergenic
1122925097 14:104895777-104895799 CCTGGGTGCAGCCGGGTGCATGG + Exonic
1123935342 15:25191360-25191382 TCTGGGTCCCACTGGATGCATGG + Intergenic
1124820709 15:33043744-33043766 CCTGGCTCCCACTGGCTGCATGG - Intronic
1125990442 15:44101483-44101505 CTTGGGTGCCTCTGGATTCCAGG + Intronic
1126305207 15:47248116-47248138 TTTGGGTTCCACTGGGTTCATGG - Intronic
1127098153 15:55534686-55534708 CTTGGGTGAAAATGGGGGCAAGG + Intergenic
1127951026 15:63806581-63806603 CTAGGGTGCCAGTGGCTGAAAGG - Intronic
1128600863 15:68994382-68994404 GTTTGGCACCACTGGGTGCATGG + Intronic
1129936878 15:79458139-79458161 CGTGGGAGCCACTGTGTGCGTGG - Exonic
1132381327 15:101368661-101368683 CCTGGGTGCCACTAGGTGTGCGG + Intronic
1132593655 16:738121-738143 CTTGCCTGCCACAGGGTGCTGGG + Intronic
1135108511 16:19671819-19671841 CCTGGCTGCCGCAGGGTGCATGG + Intronic
1137751535 16:50864533-50864555 CTTGGGTGCCCCTCTGTGCCAGG + Intergenic
1139504677 16:67392977-67392999 CTTGGATGCCACAGGGTGCTTGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141900186 16:86985883-86985905 CTTGCCTGCCGCTGGGTCCAAGG + Intergenic
1142140659 16:88471387-88471409 CGTGGGAGCCACTGTGGGCACGG - Intronic
1142140689 16:88471494-88471516 CGTGGGAGCCACTGTGGGCATGG - Intronic
1143511069 17:7395177-7395199 CTTGGGGGCCACTGGCTGAGTGG + Intronic
1143668154 17:8376672-8376694 CTCGGGGGCCTCTGGGTGGAGGG - Intronic
1146381891 17:32336644-32336666 CTTTGGTGCCAGAGGCTGCATGG + Intronic
1146980592 17:37157870-37157892 CTTGGGTGGGGCTGGGAGCAAGG + Intronic
1147460489 17:40565157-40565179 CTTTGGTGCCAGTGGGGACAAGG - Intronic
1147689678 17:42307581-42307603 CTAGGATGGCCCTGGGTGCACGG - Exonic
1147906902 17:43829498-43829520 CTGTGGTGCCTCTGTGTGCAGGG - Intronic
1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG + Intergenic
1148090412 17:45019726-45019748 CCTGAGCGCCACTGGGTGCTGGG + Intergenic
1148136125 17:45293047-45293069 CTGGGGAGGCACTGTGTGCAGGG - Intronic
1148697959 17:49572442-49572464 CCAGGGTGCAAATGGGTGCAGGG + Intergenic
1150134513 17:62688640-62688662 GTTTGTTGCCACTGGGAGCAGGG - Exonic
1151134763 17:71935567-71935589 TTTGGGAGACATTGGGTGCAGGG - Intergenic
1152582148 17:81170886-81170908 CCTGGGTGCCTGTGGGTACAGGG - Intergenic
1153774619 18:8441650-8441672 CTGGAGTGTCCCTGGGTGCAGGG - Intergenic
1157112500 18:44834211-44834233 CTTGGGAGCTTCTGTGTGCAAGG - Intronic
1158074230 18:53510261-53510283 CTGGGGTGACACTGGCTGAATGG - Intronic
1158483415 18:57843206-57843228 CTTGTGTGCCTTTGGGTGAAGGG + Intergenic
1160422316 18:78755489-78755511 GCTGGATGCCACTGGGTGCCAGG - Intergenic
1160767893 19:816528-816550 GATGGGTACCACTGGGGGCATGG - Intronic
1161262924 19:3347472-3347494 CTGGGTTGACACTGGGTGCTGGG - Intergenic
1161943354 19:7419374-7419396 TGTGGGTGCATCTGGGTGCAGGG - Intronic
1163834739 19:19566299-19566321 CTTGGCACCCACTGGGTGCCAGG + Intronic
1164502585 19:28832216-28832238 CCAGGGTGCCCATGGGTGCATGG - Intergenic
1164634492 19:29782273-29782295 CTGGGGAGCCACAGGCTGCAGGG - Intergenic
1164941048 19:32252519-32252541 GGTGGGTGTCCCTGGGTGCACGG - Intergenic
1165258053 19:34591957-34591979 CTTGTTTTCCACTGGGTGCCCGG + Intergenic
1167507881 19:49880727-49880749 CTGGGGTCACACAGGGTGCAGGG + Intronic
1168031565 19:53683691-53683713 TTTGGGTGTCACTTTGTGCAGGG + Intergenic
1168037087 19:53728437-53728459 TTTGGGTGTCACTGTGTACAGGG + Intergenic
1168637413 19:58007364-58007386 CTTGGGTGTCACTGGGTACTGGG + Exonic
1168684192 19:58338082-58338104 CTTGGATGACAAAGGGTGCAGGG - Intronic
927422422 2:22947552-22947574 CATGGGAGGTACTGGGTGCAGGG - Intergenic
927467234 2:23346646-23346668 CTTGCATCCCACTGGGTGCTGGG + Intergenic
927926614 2:27018187-27018209 CTTGGGTGGTTCTGGGGGCAAGG - Intronic
934943754 2:98521102-98521124 CTTTGTTGCCCCTGGCTGCAAGG + Intronic
937463471 2:122109556-122109578 CTTTGGTGCCAGTTGTTGCACGG + Intergenic
938170706 2:129073358-129073380 CTTTGGTGCTACTGGATGTAGGG - Intergenic
938545782 2:132330014-132330036 ATTGGGTGAAACTGGGTGAAGGG + Intergenic
940910952 2:159209569-159209591 CTTTGCTGCCACTGGGAGCTCGG - Intronic
948811164 2:240479151-240479173 CTCAGGTGCCCATGGGTGCAAGG - Intergenic
1169477116 20:5941690-5941712 CTGTGGTCCCACTGGATGCAGGG - Intronic
1171874641 20:30562745-30562767 ATTGGGTGAAACTGGGTGAAGGG + Intergenic
1172132517 20:32665027-32665049 CTTGGTGGCCACTGGGTGTCTGG + Intergenic
1173980678 20:47221549-47221571 CTTGGGTGCCACTGGGTGCAGGG - Intronic
1174650223 20:52118631-52118653 TTGGGTTGCCACTGGGGGCAAGG + Intronic
1179716159 21:43289749-43289771 CCACAGTGCCACTGGGTGCAGGG - Intergenic
1179983764 21:44910201-44910223 TCTGGGTGCCACTGGCTTCAGGG + Intronic
1180052111 21:45335941-45335963 CCTAGGTGCCACAGGGTGCCGGG + Intergenic
1180072619 21:45443906-45443928 CCTGGCTGCCACTGGGAGGACGG - Intronic
1180227191 21:46401405-46401427 CTGGTGTGTCACTGAGTGCAGGG + Intronic
1180327100 22:11439531-11439553 CTTGGGTGCAACTGTGTGTGAGG - Intergenic
1180352977 22:11819099-11819121 CTGGGGGACCCCTGGGTGCATGG - Intergenic
1180385267 22:12173258-12173280 CTGGGGGACCCCTGGGTGCATGG + Intergenic
1181046012 22:20214579-20214601 CTTGGGTGGCATTGGGCACAGGG + Intergenic
1181504281 22:23341101-23341123 CTTTGATGCCAGTGGGTACAGGG + Intergenic
1181636952 22:24178910-24178932 CCTGGGTGCCAGTGGGTGGGAGG + Intergenic
1181734550 22:24871473-24871495 CTTGAGTGCCACTGTGTGCCAGG + Intronic
1182279161 22:29208233-29208255 CTTGGCTGCCAAGGGGTGCCTGG - Intronic
1182301891 22:29341683-29341705 CTTGGCTGCCACCGGGTCCGTGG + Exonic
1182863530 22:33582133-33582155 CTGGGGTGCTACTGGATCCAGGG + Intronic
1184072598 22:42155172-42155194 CTGTGCTGCCAGTGGGTGCAGGG + Intergenic
1184476846 22:44726709-44726731 GCTGGGGGCCTCTGGGTGCAAGG + Intronic
1184902677 22:47457403-47457425 CCTGGCTCCGACTGGGTGCAAGG - Intergenic
1185089555 22:48758065-48758087 CCTGGGTGCTGCTGTGTGCATGG - Intronic
1185181992 22:49368988-49369010 CTCGGGTGACACTGGCTGCCAGG + Intergenic
950483594 3:13259794-13259816 CTTGGGTGGCATTGGCTGCATGG - Intergenic
950650860 3:14405806-14405828 CTGGGCTGGCACTGGGTTCAAGG + Intronic
950951370 3:17003658-17003680 TTTGGCTGCCACAGGGAGCAGGG - Intronic
954097315 3:48338714-48338736 CTTGGGGCCCAGTGGCTGCAGGG - Intergenic
954332028 3:49896233-49896255 CTAGGTTGGCACTGGGTGGATGG + Exonic
960939158 3:122922337-122922359 CTCGGGTGTCACCGGCTGCACGG + Exonic
960942110 3:122941833-122941855 CTTGGGGGAAACTGGGTGAAGGG + Intronic
962435629 3:135363992-135364014 CTGGGGTGACAGTGAGTGCAAGG + Intergenic
963309095 3:143688568-143688590 CTTGGCAGCCACTGGAAGCATGG - Intronic
965263391 3:166511117-166511139 GTTGGGTGGCACAGGGAGCATGG - Intergenic
965288877 3:166850110-166850132 CCTGGGAGCCACAGGGAGCAAGG - Intergenic
967106040 3:186255741-186255763 CCTGCATGTCACTGGGTGCATGG - Intronic
968139742 3:196246101-196246123 CTTTGGTGCCACTGGCTGCTAGG + Intronic
968516271 4:1016924-1016946 CCTGGGTGCCCCTGGGGGCCTGG + Intronic
968697784 4:2041306-2041328 CCCGGGGGCCACTGGCTGCACGG + Intronic
968747595 4:2368668-2368690 CCTGTGTGCCACTGTGTGGATGG + Intronic
969350093 4:6593415-6593437 ATAGGGTGGCCCTGGGTGCAGGG - Intronic
971254989 4:25006251-25006273 CTGGGGGGCATCTGGGTGCAGGG - Intronic
976948587 4:90799937-90799959 CCTGGGAGCCACTGGGGGCCAGG + Intronic
977220490 4:94332318-94332340 CTTGGGACCCACTAAGTGCAGGG + Intronic
979205618 4:118033805-118033827 CTTGGGTGCTACGCGGTGCCCGG - Intronic
980107938 4:128606392-128606414 CATTGGTGCCAATGAGTGCAAGG - Intergenic
981004326 4:139859932-139859954 CCTGAGCGCCACAGGGTGCAAGG + Intronic
981049063 4:140293217-140293239 CTGGGCTGCCACTAGGTGCCAGG + Intronic
993117205 5:83733458-83733480 GTTGGGTGGCACAGGGAGCAGGG + Intergenic
993418325 5:87665284-87665306 GATGAGTGCCACTGGGTGGAGGG - Intergenic
993743893 5:91572507-91572529 CATGGCTGCAACTGAGTGCAAGG - Intergenic
998473761 5:142403870-142403892 CTTTGGAGCCAGTGGCTGCATGG - Intergenic
999256054 5:150210575-150210597 CTTGGGGTCCAGTGGGTGAAGGG - Exonic
999527895 5:152428029-152428051 CTGTCTTGCCACTGGGTGCAGGG - Intronic
1000494854 5:161969498-161969520 ATTGGGTGAAACTGGGTGAAAGG - Intergenic
1002878876 6:1234790-1234812 TCTGGGTGTCACTGGGTGCTGGG - Intergenic
1005260467 6:24053390-24053412 CTTGGCTGCCACTGAGTGGGTGG - Intergenic
1005422732 6:25669567-25669589 CGTGAGTGTCACTGGGTGAAGGG + Exonic
1005722534 6:28617037-28617059 CCTGGGTGCCACTGCATGCCTGG - Intergenic
1006258995 6:32853146-32853168 CTCGGGAGCCTCTGGGTGCCCGG - Exonic
1006294867 6:33165806-33165828 CCTGGGGGACCCTGGGTGCAGGG + Exonic
1006295162 6:33166998-33167020 CTTGGGTCCCACAGGTTTCAGGG + Intronic
1006416807 6:33909214-33909236 CTTAGAGGCCACTGGGAGCAGGG - Intergenic
1006898628 6:37486071-37486093 CCTGGGTGTCAGTGGGTGGAAGG + Intronic
1007702530 6:43773172-43773194 CTTGGCTGTCTCTGGGAGCAGGG + Intronic
1008191960 6:48469998-48470020 ATTGGTTGCCACTGGCTGGAGGG - Intergenic
1008468504 6:51856850-51856872 TTTGGGTGCCACTGTGTGCTGGG - Intronic
1010753509 6:79640748-79640770 GTTGGGTGCGACTGAGGGCAGGG + Intronic
1011557478 6:88585993-88586015 GGTGGGTGCCACTGGGAACATGG - Intergenic
1016762741 6:147757299-147757321 CTTTGCTGCCAATGGCTGCAAGG + Intergenic
1019176904 6:170164639-170164661 CTGAGGTGCCACTGGGTCCCTGG + Intergenic
1022172037 7:27840185-27840207 CTTTCATGCCACTGGGTGGAAGG + Intronic
1023271941 7:38473143-38473165 CTTGGGTACCACAGTGTTCAAGG - Intronic
1028456384 7:91042354-91042376 CTTGAGTCTCCCTGGGTGCAGGG - Intronic
1029996699 7:105013892-105013914 CTTGAGGGCCACTGGGGGAAAGG + Intergenic
1030113998 7:106049525-106049547 TTTGGGTTCCCCTGGGTGGAAGG + Intergenic
1030935660 7:115582675-115582697 TTTGAGTGCCACTGTGTGCCAGG - Intergenic
1031693818 7:124823796-124823818 CTTGGCTTTTACTGGGTGCAAGG - Exonic
1032122922 7:129169555-129169577 CTTAGGAGACACTGGGGGCAGGG - Intronic
1032389668 7:131547773-131547795 CTTGGGGGCCACTGAGGGCTTGG - Intronic
1033364212 7:140659139-140659161 GTTGGGTACCACTGGATGGATGG - Intronic
1033648165 7:143320982-143321004 CTTGGGTGGCAGTGAGTGGAGGG - Intronic
1036205799 8:6805101-6805123 TTTGGGGGCCATTTGGTGCAGGG + Intergenic
1036655161 8:10673000-10673022 CCTGCGAGCCACTGTGTGCAGGG + Intronic
1041233905 8:55779567-55779589 CTGGGCTGCCACTGACTGCAAGG - Intronic
1041804474 8:61834938-61834960 CTTGGGACCCACCGGGCGCAGGG + Intergenic
1044490985 8:92814502-92814524 GTTGGGGGCAACTTGGTGCATGG + Intergenic
1045049095 8:98306611-98306633 TTTGGGTGCTCCTGGGGGCAGGG + Intergenic
1045239154 8:100383603-100383625 AGTGGGTGCCACTGAGTGCATGG + Intronic
1045481955 8:102600056-102600078 CTTGGGAGTCACTGTGTGTAGGG - Intergenic
1049285860 8:141774865-141774887 CCTGGGTGGCACTGTGGGCAAGG + Intergenic
1049738830 8:144224795-144224817 CTGTGGTGCCACTGGGTGCTGGG + Intronic
1050395363 9:5189200-5189222 CTTGGCTGCTCCTGGGTTCAAGG + Intergenic
1051246344 9:15115870-15115892 CTAGGGTGCTACTGGGAGCTGGG - Intergenic
1052717019 9:32129167-32129189 GTTGGGTGTCACAGGGAGCAGGG - Intergenic
1055349081 9:75366562-75366584 CTTATGTGCCACTGGGGGCATGG + Intergenic
1056421042 9:86426492-86426514 TTTTGGTGCCTCTGGGTACAAGG + Intergenic
1059439774 9:114300572-114300594 CTTGGCAGCCACTGGGTAAAGGG - Intronic
1060300070 9:122369900-122369922 CCTGGGCATCACTGGGTGCAGGG - Intergenic
1060929263 9:127478705-127478727 CTGGGCTGTCACTGTGTGCATGG - Intronic
1061487693 9:130928673-130928695 CTTGGGCGCCCGTGGGGGCAGGG + Intronic
1185556873 X:1028566-1028588 ATTGGGGGTCACTGGGAGCAAGG + Intergenic
1190120994 X:47659080-47659102 CTTGGGTGTCCCTGGGTGGTCGG - Exonic
1191221074 X:57989327-57989349 CTTGGCTCCCACTGGCTCCATGG - Intergenic
1191225691 X:58040586-58040608 GTGGGGTGCCATTGGGGGCAAGG - Intergenic
1192362111 X:70446611-70446633 CTTGGGAGCCCCTGGGTGCTGGG + Intronic
1192808795 X:74531983-74532005 TTTGGGAGCCACTGGGTGGAGGG + Exonic
1194530768 X:95045578-95045600 CTTTGGTGCCAGTGGCTGCAGGG + Intergenic
1195218325 X:102721926-102721948 CTTGGTACCCAGTGGGTGCATGG - Intronic
1197667271 X:129237460-129237482 CTTTGGAGCAACTGGGTGAATGG - Intergenic
1198059103 X:133025912-133025934 TTTGTGTGCCCCTGGGTGCCTGG + Exonic