ID: 1173983062

View in Genome Browser
Species Human (GRCh38)
Location 20:47239773-47239795
Sequence CTAGATCAGTACCATTGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173983062_1173983064 -2 Left 1173983062 20:47239773-47239795 CCAACGCAATGGTACTGATCTAG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1173983064 20:47239794-47239816 AGGATTGAGTAGCATTGCTTTGG 0: 1
1: 0
2: 1
3: 16
4: 150
1173983062_1173983065 8 Left 1173983062 20:47239773-47239795 CCAACGCAATGGTACTGATCTAG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1173983065 20:47239804-47239826 AGCATTGCTTTGGTTTTGATTGG 0: 1
1: 0
2: 0
3: 22
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173983062 Original CRISPR CTAGATCAGTACCATTGCGT TGG (reversed) Intronic
905004422 1:34698442-34698464 CTAGATGAGTAACCTTGGGTTGG - Intergenic
923193665 1:231643831-231643853 CTCGGCCAGTACCATTGTGTGGG - Intronic
1064613723 10:17130899-17130921 CTAGGTAATTACCATTGCATTGG + Intergenic
1084414189 11:69021408-69021430 CTTGATCAGAAGCAATGCGTGGG + Intergenic
1095293012 12:40497827-40497849 CTAGATCTTTACCATTGCCTAGG - Intronic
1107389257 13:39945951-39945973 CTAGTTAAGAACCATTGCTTGGG - Intergenic
1121875489 14:97447440-97447462 CTAGGTCAGTTACATTGAGTGGG + Intergenic
1126358628 15:47822683-47822705 TTAGCTCAGTTCCATTGCATGGG + Intergenic
1137903026 16:52289778-52289800 CTAAATCAGTACAATTACGGTGG + Intergenic
1148897109 17:50845429-50845451 CCAGATCAGAATCATTGCCTAGG + Intergenic
1149352602 17:55806350-55806372 CAAGTTCAGTACCATTACGTTGG + Intronic
926176482 2:10596675-10596697 CCAGACCAGTACCATGGCCTAGG + Intronic
936065439 2:109328626-109328648 CTATATCAGTACCATGACCTAGG - Intronic
938911457 2:135889209-135889231 CTAGATCAGTCTCAGTGAGTGGG + Intergenic
1171017486 20:21555148-21555170 CTGGATCAGTGCCAGGGCGTTGG - Intergenic
1173983062 20:47239773-47239795 CTAGATCAGTACCATTGCGTTGG - Intronic
1174729950 20:52906334-52906356 CTAGAGCAGTGCCATTCAGTAGG - Intergenic
951961819 3:28333941-28333963 CTAGATCAGTAAAATTAAGTTGG - Intronic
956583928 3:70844011-70844033 CCAGATCAGGCCCATTGCCTCGG - Intergenic
956913702 3:73848643-73848665 CTGGATCAGTAGCAATGCCTGGG + Intergenic
962539671 3:136366757-136366779 TTATATCAGTTCCATTGAGTAGG - Intronic
966712117 3:182981073-182981095 CTACATCAGTTCCCTCGCGTGGG + Intronic
979704450 4:123705629-123705651 CTAGATCAGTTACATTGCTGCGG - Intergenic
980569836 4:134600271-134600293 CTTGATCTGTGCCATTGCATGGG + Intergenic
992314177 5:75535961-75535983 CTAGTTAAGAACCATTGCCTGGG + Intronic
1000554292 5:162705709-162705731 CTAAATCAGAACCTTTGCATTGG + Intergenic
1005325534 6:24696486-24696508 CTAGATAAGTACCATTTATTAGG - Intronic
1009021666 6:57953510-57953532 CTAGATGAGTAACATTGGATGGG - Intergenic
1017636542 6:156449568-156449590 CTGGATCAGTATCATTTTGTGGG - Intergenic
1026617327 7:71917062-71917084 CTAGCTCATTACCATTTCTTAGG - Intronic
1032964217 7:137077106-137077128 CTAGATCTGAACCTTTGTGTAGG - Intergenic
1039266687 8:35832212-35832234 CTAGATTACTAACATTGCCTGGG - Intergenic
1045769639 8:105720873-105720895 CTAGAACAGTCCCATTGTTTTGG + Intronic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1052694201 9:31854892-31854914 CTGGATAAGAACCATTGCGGGGG - Intergenic
1187641195 X:21292157-21292179 CTAGTTAAGAACCATTGCTTGGG + Intergenic
1191792102 X:64981980-64982002 CTAGGTCAGTGACATTGGGTAGG - Intronic
1198579747 X:138049971-138049993 CTGGTTCAGAACCATTGCATGGG - Intergenic