ID: 1173984357

View in Genome Browser
Species Human (GRCh38)
Location 20:47249705-47249727
Sequence CAGCCAGATGGCTCAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173984352_1173984357 26 Left 1173984352 20:47249656-47249678 CCACTGAACAATCGTCTGGGTGA 0: 1
1: 0
2: 0
3: 47
4: 1137
Right 1173984357 20:47249705-47249727 CAGCCAGATGGCTCAGTGTGTGG 0: 1
1: 0
2: 3
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173984357 Original CRISPR CAGCCAGATGGCTCAGTGTG TGG Intronic
900979567 1:6038813-6038835 CAGCCACTTGGCTAAGTGTCAGG + Intronic
901230666 1:7640238-7640260 CAGCCAGATGGTTCTGTGGTGGG - Intronic
901402792 1:9025898-9025920 CAGCCAGGCAGCTAAGTGTGAGG - Intronic
901731896 1:11285941-11285963 CAGGCTGATGGTGCAGTGTGTGG - Exonic
904690036 1:32286968-32286990 CAGCCAGAGGGAACAGGGTGAGG + Intergenic
905354689 1:37373193-37373215 AAGCCAGCTGCCTCAGTGAGTGG - Intergenic
905931100 1:41788220-41788242 CAGCAATGTGCCTCAGTGTGAGG + Intronic
907459348 1:54596109-54596131 CAGCCAGAAGGCCCAGTGCCAGG - Intronic
907671835 1:56481299-56481321 GAAACAGATGGCCCAGTGTGGGG - Intergenic
911162755 1:94698036-94698058 GAGCCAGATGGCCCTCTGTGAGG - Intergenic
912383050 1:109257902-109257924 CAGCCATGGGGCTCAGTGGGAGG + Intronic
913474998 1:119228502-119228524 CAGACACCTGACTCAGTGTGAGG - Intergenic
915321951 1:155061202-155061224 CAAGCAGAGGGCTCAGGGTGGGG - Intronic
917083463 1:171281069-171281091 CAGCAACATGGCTGAATGTGTGG + Intronic
919864476 1:201770038-201770060 CAGCCAGAGGGCCAAGGGTGTGG - Intronic
920408365 1:205737540-205737562 CAGAATGATAGCTCAGTGTGAGG - Intronic
920651391 1:207840008-207840030 CAGCCAAGTGTCACAGTGTGAGG + Intergenic
923686567 1:236157527-236157549 CAGAAGGATGGCTAAGTGTGTGG - Intronic
1068119691 10:52772796-52772818 CTGGCAGATGCCTCAGAGTGAGG + Intergenic
1069746456 10:70717828-70717850 CAGCCAGGTGGGGCAGGGTGGGG - Intronic
1070196010 10:74157118-74157140 CTGCCAGATGGCTCAGAGTCAGG + Intronic
1071589378 10:86857710-86857732 AAGCCAGCTGTCACAGTGTGAGG - Intronic
1072186304 10:93042204-93042226 CAAGCAGATGGAACAGTGTGAGG - Intronic
1072683601 10:97523946-97523968 CAGCCAGCAGGATGAGTGTGGGG + Intronic
1073609444 10:104928706-104928728 CTGCCAGATGGCTCAGGGGTGGG + Intronic
1074134865 10:110617528-110617550 CACACAGTTGGGTCAGTGTGTGG - Intergenic
1074879877 10:117647487-117647509 CAGCCAGATGGGCCTGTTTGAGG - Intergenic
1076177282 10:128377762-128377784 CAGCCAATTGGCAGAGTGTGGGG + Intergenic
1076217395 10:128707124-128707146 CAGCCAGAAGGCTCCTTGGGGGG + Intergenic
1076981991 11:209453-209475 CAGCCAGATGACACGGTGGGAGG - Exonic
1078182851 11:9027176-9027198 CAGCAAGACGCTTCAGTGTGTGG + Intronic
1080272313 11:30463513-30463535 CAGCCAGCAGGCTCAGTCTCTGG + Intronic
1083773233 11:64879660-64879682 CAGCCAAAGGGGTCTGTGTGTGG - Intronic
1084169255 11:67392588-67392610 CAGCCAGAGGGCTGGGTCTGTGG + Intronic
1084697174 11:70762672-70762694 CATCCAGATGGCTCATACTGAGG - Intronic
1084748324 11:71187661-71187683 CAGGCAGAAGCCTCAGTGGGAGG + Intronic
1088708799 11:112487625-112487647 CATCTAGATGGCTGGGTGTGGGG + Intergenic
1089733237 11:120532538-120532560 CAGCCAGCCGGCTCAGAGGGAGG - Intronic
1091766641 12:3124705-3124727 CAGCCTGATGGACCACTGTGTGG + Intronic
1092265481 12:6977480-6977502 CGGCCAGCTTGCTCAGGGTGGGG + Exonic
1098570140 12:71979314-71979336 CAAGCAGATGGCTCAGTGTTGGG - Intronic
1099329747 12:81268514-81268536 GAGCCAGATGGATTAGAGTGTGG - Intronic
1101570759 12:105951587-105951609 CAGCCTGATGGGTCAGGGAGAGG + Intergenic
1101674019 12:106901443-106901465 CAAGCAGATGGCTTAGTCTGGGG - Intergenic
1102184491 12:110937115-110937137 CAGCCAGATGGATCTGCGGGAGG - Intergenic
1102965949 12:117125529-117125551 CAAACAGATGGCCCAGGGTGAGG - Intergenic
1106645054 13:31625198-31625220 AAGCCAGATGGCTCTGTGCCAGG + Intergenic
1106765626 13:32910909-32910931 CAAAAAGATGTCTCAGTGTGGGG - Intergenic
1107727767 13:43317145-43317167 AAGTGAGATGGCTCAGTCTGAGG - Intronic
1110802933 13:79721316-79721338 AAGGCAGAAGGGTCAGTGTGGGG + Intergenic
1112721514 13:102251329-102251351 CAGTCAGAAGGCTCTGAGTGAGG + Intronic
1113828058 13:113272230-113272252 CAGTCTGAAGGCTCAGTGGGTGG - Intergenic
1115405066 14:33005977-33005999 CAGCCAGCTGGCTCATGGGGAGG - Intronic
1117615288 14:57528176-57528198 CAGACAGATGGAATAGTGTGTGG - Intergenic
1118982742 14:70729813-70729835 AAGCAAGGTGGCCCAGTGTGGGG - Exonic
1119788015 14:77327175-77327197 CATCCAGAGGGCCCAGTATGGGG - Intronic
1120320648 14:82956311-82956333 CAGCCAGCCTGCTCACTGTGAGG - Intergenic
1120330861 14:83091707-83091729 CACCCACATGTCTCAGTTTGGGG + Intergenic
1122820961 14:104344603-104344625 CAGACAGAAGCCTCAGTCTGGGG + Intergenic
1125083411 15:35701907-35701929 CAGACAGATAGCACAGTGGGAGG - Intergenic
1125190506 15:36987060-36987082 CTGCCAGATCACTCAGTGTGGGG + Intronic
1127288995 15:57553933-57553955 CAGCCTTTTGGCGCAGTGTGTGG + Intergenic
1128712661 15:69883900-69883922 CAGGCAGATGGCTTGGAGTGCGG + Intergenic
1129247982 15:74291596-74291618 CAGCAAGAAGGCTCAGGGCGGGG + Intronic
1129410758 15:75349076-75349098 CAGGCAGAGGGCTCAGTATCAGG - Exonic
1129519704 15:76177994-76178016 CAGGCAGAGGGAACAGTGTGGGG + Intronic
1131176054 15:90210503-90210525 CAGCCAGGTGGCCCAGGGTCGGG + Intronic
1132160727 15:99539208-99539230 CAGCTAGATGGCCCAGGGTGGGG + Intergenic
1133402749 16:5500654-5500676 CAGCCAGCAGCCTCAGTGTATGG + Intergenic
1134055279 16:11166143-11166165 CAGCCACAGAGCTGAGTGTGGGG - Intronic
1134913301 16:18048652-18048674 CAGCCAGATGGCTGTGTGTTTGG + Intergenic
1135406471 16:22201725-22201747 CATCCAGATGGCTCTGTGTTGGG + Intergenic
1135490461 16:22904954-22904976 CTGCCACATGGCTCAGTGTGTGG + Intronic
1135847471 16:25931814-25931836 AAGCCATATGGCTCTGTCTGGGG + Intronic
1137864517 16:51879528-51879550 AGGCCAGATGCCTCAGTTTGTGG + Intergenic
1139088534 16:63617414-63617436 CAGCCAGCTGGCGGAGTGCGGGG + Intergenic
1139138205 16:64230872-64230894 CAGCCAAGTGGCTCAGACTGGGG - Intergenic
1142275700 16:89117775-89117797 CAGACAGATGGCACAGGGAGAGG + Intronic
1142356875 16:89605490-89605512 CAGCCGGAGGGCTCCGTGGGGGG + Intergenic
1144327248 17:14193957-14193979 CAGGCAGGTGGCTCAGTGCAGGG - Intronic
1144359200 17:14475605-14475627 CAGCCAGAGGGGGCAGTTTGTGG + Intergenic
1144503074 17:15806424-15806446 CACTCAGATGGCTCTGAGTGTGG - Intergenic
1144839801 17:18178897-18178919 CTGCCAGAAGACTCACTGTGTGG + Exonic
1146461734 17:33051321-33051343 GAGACAGCTGGTTCAGTGTGCGG - Intronic
1147137867 17:38444478-38444500 CAGAAACCTGGCTCAGTGTGGGG - Intronic
1148191612 17:45682306-45682328 CATCCAAATGGATCAGTGTCGGG + Intergenic
1151488520 17:74417758-74417780 CAGCCAGTTGGGTCAGACTGTGG + Intergenic
1151884942 17:76918000-76918022 CAGCCAGCGGGGTGAGTGTGTGG + Intronic
1152876914 17:82791618-82791640 CAGCCAGAAGGCTCAGTGATGGG + Intronic
1152989063 18:345963-345985 CAGCCAGCTGCCACATTGTGAGG + Intronic
1153607027 18:6844937-6844959 CAGCCAGAAGTCAAAGTGTGGGG + Intronic
1153824644 18:8864339-8864361 CAGCCATATGTCCCAGTGTCAGG - Intergenic
1156838928 18:41588588-41588610 TAACCAGATGCCACAGTGTGGGG - Intergenic
1158282011 18:55838643-55838665 AAGCCAGAGGGCTCAGTCAGAGG + Intergenic
1158629826 18:59102125-59102147 AAGCAACATGGCTCAGAGTGAGG - Intergenic
1160200111 18:76788928-76788950 CAGCCAGCTGTCTCAGCTTGCGG - Intergenic
1160754895 19:751913-751935 CAGCCAGTTGGCTCTATGTGAGG - Intronic
1161489484 19:4554044-4554066 CAGACAGATGGGTAAGTGGGAGG + Intronic
1162175185 19:8824922-8824944 AAGCCAGATTGCACCGTGTGAGG - Intronic
1162416171 19:10539219-10539241 CAGCCAGATGGCTCAGATAAGGG - Intergenic
1163020223 19:14477617-14477639 CAGCCAGAAGGAACAGTGGGAGG + Intergenic
1163208360 19:15821115-15821137 CAGCCAGAAGGCTCAGAGAGGGG + Intergenic
1165893857 19:39130138-39130160 CAGGCAGAGGGGTCAGGGTGGGG + Intronic
1165973616 19:39655384-39655406 AAGCCAAGTGGCTTAGTGTGGGG + Intergenic
1167451552 19:49573197-49573219 CAGCCAGCTGGCACAGTGGATGG - Intronic
1167652767 19:50742089-50742111 CACCCACATGGCTGAGTATGTGG - Intergenic
1167736688 19:51298932-51298954 CAGCGACATGTCTCAGTGTTTGG + Intergenic
1168557657 19:57356589-57356611 CAGCCAGATGACTCATGCTGAGG + Exonic
925683303 2:6445653-6445675 CAGCCCCATGGCTCAGTAAGTGG + Intergenic
925971882 2:9111775-9111797 CAGCACGATGGCACAGTGCGTGG + Intergenic
927554212 2:24021274-24021296 CATCCACAGGGCTCAGAGTGTGG - Intronic
927575709 2:24200478-24200500 CAGCAGGAGGGCTGAGTGTGGGG + Intronic
928389750 2:30900010-30900032 CAGGATGATGGCTCAGTGTGTGG + Intergenic
928456964 2:31431054-31431076 CAGCCAGCAGGCACAGTGGGTGG + Intergenic
931426524 2:62176911-62176933 CAGTCTGATGGCCCAGTATGAGG - Intergenic
932439096 2:71720546-71720568 CAGCAAGATGGCTTAATGTCAGG - Intergenic
932555337 2:72818838-72818860 AAGCCATATGGCTCTCTGTGAGG - Intronic
934763281 2:96867860-96867882 CAGCCAGACAGCCCAGTGTGGGG + Exonic
935742387 2:106161112-106161134 CAGGCAGCTGGCTCAGCATGTGG - Intronic
936168820 2:110149516-110149538 CAGTGAGAGGGCTCAGGGTGTGG - Intronic
936225222 2:110643113-110643135 CAGCCATTTGGCTTACTGTGAGG - Intronic
941764868 2:169285629-169285651 CAGCCAGATGGATCAGAGGGTGG - Intronic
947777950 2:232729683-232729705 CAAGCAGATGGCTTAGTCTGGGG - Intronic
947821774 2:233076859-233076881 CAGCCAGTTGGCAGGGTGTGGGG + Intronic
948489572 2:238303799-238303821 CAGCTGCATGGCCCAGTGTGGGG + Intergenic
1169126161 20:3128469-3128491 CAGGCAGATGGCTGAGGTTGGGG + Intronic
1170824177 20:19779164-19779186 CAGAAAGATGTCTCAGTGAGAGG + Intergenic
1173984357 20:47249705-47249727 CAGCCAGATGGCTCAGTGTGTGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175106346 20:56617708-56617730 CAGGGAGGTGGCTCAGTGTAGGG + Intergenic
1175815251 20:61880246-61880268 CAGGCAGATGCCTCTGGGTGGGG - Intronic
1176101936 20:63368379-63368401 CAGCCAGAGGGCAGGGTGTGAGG - Intronic
1182033707 22:27181211-27181233 CAGCCAGGTGGGTAAGTGGGGGG - Intergenic
1182376354 22:29851304-29851326 CAGAAACATGGCTTAGTGTGAGG + Intergenic
1183059955 22:35330297-35330319 CAGTCACATGACTCAGAGTGAGG - Intronic
1183499186 22:38168276-38168298 CAGCCAGATGGATAGGTGAGCGG + Intronic
1184240492 22:43209071-43209093 CAGCCAAAAGCCGCAGTGTGCGG - Intronic
1184769563 22:46589429-46589451 AGGGCAGATGGCCCAGTGTGGGG + Intronic
1185315008 22:50175192-50175214 CAGACACGTGGCTCGGTGTGGGG + Intronic
949300167 3:2574530-2574552 TCGCCAGATGACTCAGTGTCTGG + Intronic
950032746 3:9863046-9863068 CATCCCGATGGCTCAGAGTCGGG - Intergenic
950309938 3:11948488-11948510 CAGACAGATGGCTGGGTGGGTGG + Intergenic
950465388 3:13150304-13150326 CAGCCTGAACGCTCACTGTGAGG - Intergenic
951616684 3:24555057-24555079 CATCAAGATGGTACAGTGTGGGG - Intergenic
954131658 3:48564187-48564209 CTGGCAGATGACTCACTGTGGGG - Exonic
954935506 3:54323113-54323135 GAGCCACATGGCTCACAGTGAGG - Intronic
955297177 3:57746636-57746658 CAACCAGATGGATCAGTTTGGGG - Intergenic
955982456 3:64540668-64540690 CAGGCACAGGGGTCAGTGTGGGG - Intronic
956466655 3:69526492-69526514 CAGCCTGTTGCCTCCGTGTGGGG - Intronic
960726173 3:120672519-120672541 CCCCCAGATGGCTCAATGTTGGG - Intronic
960868003 3:122221414-122221436 CACCTAGATGGCTCACAGTGGGG + Intronic
961441224 3:126954477-126954499 CAGCCACATGACTCAGGCTGGGG + Intronic
961659043 3:128458660-128458682 GAGCCAGATGGGGCAGTGAGAGG - Intergenic
965347920 3:167575233-167575255 AAGCCAGTGAGCTCAGTGTGGGG - Intronic
966084884 3:176058566-176058588 AAGTCAAATGGCTGAGTGTGGGG + Intergenic
967323111 3:188213397-188213419 AAGACAGATGGCTCATTATGTGG + Intronic
969470595 4:7385359-7385381 AAGCCAGCTGGCTCAGTGCTGGG - Intronic
969746802 4:9079080-9079102 CAGCCAGATGGTCCAGGTTGGGG - Intergenic
970587842 4:17531381-17531403 CTTCCAGATGGCTGAGTATGTGG + Intergenic
975023688 4:69521726-69521748 CAGCCAGAACCCTCTGTGTGTGG - Intronic
984163770 4:176284499-176284521 CTGCTTGATGGCTCAGTGTGGGG + Intergenic
984851008 4:184152408-184152430 CAGCCTGATGGGTCTGTGAGTGG - Intronic
985842663 5:2320501-2320523 AAGTCACATGGATCAGTGTGTGG + Intergenic
986180202 5:5385835-5385857 TATCCAAATGTCTCAGTGTGAGG + Intergenic
990654651 5:57941714-57941736 CAGGCAGATGAGACAGTGTGTGG + Intergenic
991962412 5:72058361-72058383 CAGCCAGATGAGCCAGTGTCAGG + Intergenic
994743513 5:103650182-103650204 GAACAAGATGGCTCAATGTGGGG - Intergenic
998040969 5:138950891-138950913 CAGGCAGAGGGCTCAGTATGAGG - Intronic
1000194039 5:158940722-158940744 CAGTCAGAAGGCTAATTGTGTGG - Intronic
1001906732 5:175479020-175479042 CAGCCAGGTGGCCCAGTGCCTGG + Intronic
1003309557 6:4957614-4957636 CCACCAGATGGCTCAGTGAGCGG - Intergenic
1004688124 6:17967720-17967742 AAGGCAGATGGCTCAGTGGCTGG - Intronic
1006459128 6:34148128-34148150 CTGGCAGATGGCTGAGTTTGTGG + Intronic
1006679615 6:35787624-35787646 CAGGCAGATGGGTCAGTGACAGG + Intronic
1007117301 6:39351917-39351939 CAGCGAGAGGGCTCCGTGTGTGG + Intronic
1007848165 6:44778164-44778186 CATCTAGATGGCTAGGTGTGGGG - Intergenic
1010965148 6:82196901-82196923 CAGTCAGCTGGCTAAGTGAGAGG - Intronic
1017590398 6:155973163-155973185 CATCCAGCTGGCTCAGTTTTAGG + Intergenic
1019525360 7:1478208-1478230 CTCCCAGATGGCTCAGGGCGGGG - Intronic
1021901676 7:25291617-25291639 GAGCCAGATGGCTTATTTTGTGG - Intergenic
1023967364 7:44969938-44969960 CTGACAGGTGGCTGAGTGTGGGG - Intronic
1028007297 7:85591074-85591096 CAGCCAGATTTCTGAGTCTGAGG - Intergenic
1029489797 7:100864628-100864650 CAGCTCGGTGGCTCAGAGTGTGG + Intronic
1029696328 7:102215836-102215858 CTGCCTGTTGGCCCAGTGTGCGG - Intronic
1030426790 7:109387980-109388002 CAGCCAGGTGGCTCAGTCTGTGG + Intergenic
1030502733 7:110380423-110380445 CAGCCAGTTGGCCCGGTGTGGGG - Intergenic
1033576068 7:142686097-142686119 CACCCTGATGGCTCATTGAGTGG - Intergenic
1034422900 7:150998630-150998652 CAGCAGGATGGCTCTGTGCGGGG + Exonic
1035380813 7:158439767-158439789 CAACAAGATGGCCCAGTCTGTGG + Intronic
1037632591 8:20671806-20671828 CAGCCATGTGGCTCAATATGTGG - Intergenic
1037741256 8:21610928-21610950 CAGCCAGCTGGGTTTGTGTGTGG - Intergenic
1042868368 8:73375964-73375986 CAGCAGCATGGCTCAGTTTGGGG - Intergenic
1045369204 8:101504711-101504733 CAGTCAGATGAGTCACTGTGTGG - Intronic
1046407182 8:113790259-113790281 CAGCCAGATATCTCAGTGGTTGG + Intergenic
1055176576 9:73325062-73325084 CAGCCAGCTTGATAAGTGTGTGG - Intergenic
1056636038 9:88332030-88332052 CTACCAGATTGCTCACTGTGGGG - Intergenic
1057937613 9:99253940-99253962 CAAACAGATGGCCCCGTGTGGGG + Intergenic
1060044054 9:120326063-120326085 CACCCAGAAGGCTCAGGGGGAGG - Intergenic
1062112317 9:134788837-134788859 CAGGCAGATGGATGAGTGGGAGG + Intronic
1187246562 X:17557918-17557940 CAGCCAGATTTATCAGGGTGAGG + Intronic
1187435800 X:19267919-19267941 CAGTCAGAAGGCTCAGGGAGAGG + Intergenic
1189356245 X:40311970-40311992 CAGCCAGCTGGGTGGGTGTGTGG + Intergenic
1195533199 X:105981730-105981752 CAGTCAAATGGCTTAGTTTGTGG + Intergenic
1196656933 X:118228265-118228287 CAGACGGCTGGCTCACTGTGAGG + Intergenic
1197675215 X:129322599-129322621 CAGCCAGATGGTTGAGGGTCTGG - Intergenic
1198203529 X:134445213-134445235 CAGCCAGATGGAAGAGTGTCAGG + Intergenic
1199522972 X:148758097-148758119 CAACCAGATTGCTCAGTGTGAGG - Intronic