ID: 1173990965

View in Genome Browser
Species Human (GRCh38)
Location 20:47303147-47303169
Sequence AATTTATTGTAGGGGTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173990955_1173990965 25 Left 1173990955 20:47303099-47303121 CCACTAATGTAGAGGGTCTGCTC 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1173990965 20:47303147-47303169 AATTTATTGTAGGGGTATGGGGG 0: 1
1: 1
2: 1
3: 19
4: 197
1173990958_1173990965 -2 Left 1173990958 20:47303126-47303148 CCTAGGAAAATGGTTGCTTCGAA 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1173990965 20:47303147-47303169 AATTTATTGTAGGGGTATGGGGG 0: 1
1: 1
2: 1
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173990965 Original CRISPR AATTTATTGTAGGGGTATGG GGG Intronic
906161517 1:43652634-43652656 AATTTAGGGTGGGGGTGTGGTGG - Intronic
906184865 1:43854189-43854211 TATTCCTGGTAGGGGTATGGGGG - Intronic
908398921 1:63751930-63751952 AATTTTTTGTGTGGGGATGGGGG + Intergenic
909463491 1:75945686-75945708 TATTTATTGTTGTGGTTTGGTGG - Intergenic
911117466 1:94260612-94260634 AATGCTTTGTAGGGGTATGGGGG + Intronic
911923563 1:103797703-103797725 AATTTATTGGAGGGATGTTGGGG + Intergenic
912276907 1:108268545-108268567 AATTTCTTGTAGGGGTGGGTGGG + Intergenic
912291322 1:108425811-108425833 AATTTCTTGTAGGGGTGGGTGGG - Intronic
914697165 1:150095235-150095257 AAGTAATTGTAGGGGTGGGGAGG + Intronic
916693198 1:167210684-167210706 AAATAATTGTCTGGGTATGGTGG + Intergenic
917106438 1:171497076-171497098 AATGTATTGGTGGGGCATGGTGG - Intronic
918279442 1:182989483-182989505 AAGTTATTGGTGGGGCATGGTGG + Intergenic
919455673 1:197817472-197817494 AATTTATTGGCTGGGTATGGTGG - Intergenic
923013991 1:230112010-230112032 AATTTATTGTGGGGACATGGTGG + Intronic
924417599 1:243873885-243873907 AGTTTATTGAATGGATATGGAGG + Intergenic
1063318367 10:5029469-5029491 AATTTATTGGCCGGGCATGGTGG + Intronic
1064560930 10:16595068-16595090 ATTTTTTTGTTGGGGCATGGTGG - Intronic
1066518393 10:36189153-36189175 ACTTTAATGCAGGTGTATGGGGG - Intergenic
1067824068 10:49557051-49557073 TGGTTATTGTAGGGGCATGGGGG + Intergenic
1069318295 10:67135520-67135542 AAATAATTAAAGGGGTATGGTGG + Intronic
1070039891 10:72766040-72766062 AATTTTTTGTAGAGATGTGGGGG + Intronic
1070904969 10:80064071-80064093 AATTTATTGGCCGGGTATGGTGG + Intergenic
1071984491 10:91036818-91036840 AATTTATTGGAGGAATAAGGGGG - Intergenic
1073255925 10:102151295-102151317 AATTTTTTGTAGAGATAGGGGGG + Intergenic
1074570829 10:114622414-114622436 AAATTTTTGTCGGGGGATGGGGG + Intronic
1077959418 11:7058168-7058190 ATTTTATAGTTGAGGTATGGGGG + Intronic
1079187690 11:18252368-18252390 AATTTATTGGCTGGGTGTGGTGG - Intergenic
1079637680 11:22765237-22765259 TATTTTTTGTACGTGTATGGAGG - Intronic
1080133023 11:28818597-28818619 AACTTAGTGTAGGGGTGTGGAGG - Intergenic
1080984117 11:37441399-37441421 AATTTTTTGTAGGCATATTGTGG + Intergenic
1081133293 11:39406829-39406851 AATTTATGGTAGGGGTATGGTGG + Intergenic
1081411345 11:42762084-42762106 AATTTACTGTAGGGGTACAGAGG + Intergenic
1084987279 11:72886606-72886628 AATGTGGTGAAGGGGTATGGAGG - Intronic
1086381290 11:86257503-86257525 AATTTATTGTAGCACTATGTTGG + Exonic
1086813433 11:91338405-91338427 AATTTTTTGTAAGGGTACTGTGG - Intergenic
1090141352 11:124266927-124266949 AATTTATTGGTCGGGTGTGGTGG - Intergenic
1091483206 12:856158-856180 AATTTATTGGCTGGGTATGGTGG + Intronic
1092031731 12:5292053-5292075 CACTTATTATAAGGGTATGGAGG - Intergenic
1092458673 12:8667543-8667565 AATGTATTGAAGTGATATGGGGG + Intergenic
1095466219 12:42490443-42490465 AAGTTATTCTAGGGGTAGTGGGG + Intronic
1096615138 12:52828074-52828096 AATTCATTCTATGGGTCTGGAGG - Intronic
1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG + Intergenic
1098612166 12:72472199-72472221 ATTTTATTGTAGAGGTAGGGGGG - Intronic
1099234330 12:80064826-80064848 AATTTAATATAGGGGCATTGTGG + Intergenic
1100828144 12:98493821-98493843 TATTTTTTGTAGAGGGATGGTGG - Intronic
1100854883 12:98749882-98749904 GATATATTTTAGGGGTAGGGTGG + Intronic
1101123784 12:101610351-101610373 ACTTTACAGTAGGGGTATGAGGG + Intronic
1104034855 12:125091224-125091246 AATGGATTGCAGGGGGATGGTGG + Intronic
1105362942 13:19737556-19737578 AATTTAGTGTTTGGTTATGGTGG + Intronic
1105685231 13:22774534-22774556 AAATTATTTTAGGGGTATGAAGG - Intergenic
1105897494 13:24728580-24728602 AATTTATAGTCTGGGTGTGGTGG - Intergenic
1106732688 13:32557925-32557947 AATTTCTTGTAGGGGGAAAGGGG + Intergenic
1107420372 13:40240466-40240488 TATTTAGTGTAGGGATATCGAGG - Intergenic
1108696346 13:52905801-52905823 ATTTTATTGTGGGGTTTTGGTGG + Intergenic
1109717667 13:66237302-66237324 GATTTATTGTAAGGGAATAGAGG - Intergenic
1111406705 13:87816066-87816088 ATTTGATTCTAGGGTTATGGTGG - Intergenic
1111472366 13:88699770-88699792 AATTTTTTGTAAGAGTTTGGGGG + Intergenic
1114300092 14:21368094-21368116 AATTTCTTGTAGAGATATGGGGG + Intronic
1116015820 14:39405488-39405510 AATTTTTTGGGGGGGTGTGGAGG + Intronic
1116746022 14:48820174-48820196 AATTTATTTTAGCAGTTTGGGGG + Intergenic
1117232594 14:53736553-53736575 AATTTATTGTAAGGGAAAGAAGG + Intergenic
1120650171 14:87122984-87123006 AATTTATTTCAGGTGTTTGGGGG + Intergenic
1124097362 15:26660956-26660978 AATTATTTGTAGAGGTGTGGGGG + Intronic
1128371231 15:67040879-67040901 AATTTTTTGTAGAGACATGGGGG - Intergenic
1128593120 15:68920266-68920288 ACTTTATTGGTGGGGTATGGTGG - Intronic
1129093047 15:73171926-73171948 AATTTATTGGCCGGGCATGGTGG - Intronic
1129807674 15:78477932-78477954 AATTTATTGGCGGGGTGTGGTGG + Intronic
1131055820 15:89374237-89374259 AATTTTTTGTGGGGGTGGGGAGG - Intergenic
1131161610 15:90108740-90108762 CTTTTATTGGAGGGGTCTGGGGG - Intergenic
1134386705 16:13780190-13780212 AATTCATTGCAGGGTTTTGGAGG + Intergenic
1138244797 16:55459625-55459647 ATTTTTTTGTAGGGGGAGGGAGG - Intronic
1138912377 16:61416915-61416937 AATTTCTTGCATGGGCATGGTGG - Intergenic
1138979715 16:62252985-62253007 CTTTTATTGTAGGGGGATTGAGG + Intergenic
1139033483 16:62914280-62914302 AATTGATTGTAAGAATATGGGGG - Intergenic
1139103279 16:63795640-63795662 AATTTATTGAAGAGGGAGGGGGG + Intergenic
1139691437 16:68644565-68644587 AATTTTTTGTAGCGATGTGGTGG - Intronic
1140034630 16:71363006-71363028 AATTTGTAGTAGGGGGAGGGGGG - Intronic
1140282464 16:73567019-73567041 AATTTTTTGTAGAGATAGGGGGG + Intergenic
1140554682 16:75908261-75908283 ATTTTAGTGGAGGGGTATGTGGG + Intergenic
1143216954 17:5232308-5232330 GATTTGTTCTAGGGGTGTGGGGG + Intronic
1143876941 17:9998816-9998838 CATTTATTAGAGGGATATGGGGG - Intronic
1144097403 17:11913493-11913515 AATTTATTGTCCGGGCACGGTGG + Intronic
1146134957 17:30311430-30311452 ACTTTACTGTAGGGATATGTTGG + Intergenic
1146154849 17:30514291-30514313 AAATTATTTTAGGGTAATGGAGG - Intronic
1147335952 17:39727111-39727133 AATTTTTTGTAGGGATAATGGGG - Intronic
1149167639 17:53772473-53772495 AATTTATTTCAAGGGTATTGAGG - Intergenic
1149275840 17:55034756-55034778 AATTTTTTGTGGGGGTACAGGGG - Intronic
1149818350 17:59749242-59749264 AATTTATTGGCTGGGCATGGTGG - Intronic
1149886465 17:60344740-60344762 AATTTATTGGCTGGGTATGTTGG - Intronic
1150184908 17:63170138-63170160 AATTTATTGGCGGGGCATGGTGG + Intronic
1150730218 17:67686201-67686223 AATTTTTTGTTGGGGGCTGGGGG + Intronic
1157676796 18:49574615-49574637 ATTTTTTTGTAGCTGTATGGTGG + Intronic
1159966841 18:74603100-74603122 AGTTTATTGTAAGGGCATTGGGG + Intronic
1160330244 18:77984488-77984510 CATTTATTGTAGGAGTATGGCGG - Intergenic
1164439851 19:28267026-28267048 ATTTTATTTTATGGATATGGGGG + Intergenic
1168251445 19:55144555-55144577 AATTTTTTGTAGAGATGTGGGGG + Intronic
927405185 2:22758308-22758330 AGGTCATTGAAGGGGTATGGGGG - Intergenic
927924510 2:27001351-27001373 AATATATGGTCTGGGTATGGTGG + Intronic
928054369 2:28036725-28036747 AATTTATTGAAAGGATATGAGGG - Intronic
928946089 2:36773455-36773477 AATTTATTGGCCGGGTGTGGTGG + Intronic
930395833 2:50823403-50823425 ATTTTATTGTAGTTGTATGATGG - Intronic
930678153 2:54226747-54226769 GATTTGTTGTAAGGGAATGGTGG - Intronic
932178895 2:69627640-69627662 AAGCTATTGTAGGGGTTTGCAGG + Intronic
939199150 2:139012621-139012643 GTTTTCTTGTAGGAGTATGGTGG + Intergenic
942859562 2:180592939-180592961 AATTTATAGTAGGGTTTAGGGGG + Intergenic
943592879 2:189820472-189820494 TTTTTTTTGTAGGGATATGGGGG + Intronic
943716134 2:191154261-191154283 ATTTTATTGTAAGTGCATGGTGG + Intergenic
944059463 2:195557111-195557133 ATTTTATTGGAGGGGCATGATGG - Intergenic
944650808 2:201828598-201828620 AATTTATTGTGGGTATATGGAGG + Intronic
944675076 2:202028722-202028744 AATTTTTTATAGTGGTATGCTGG - Intergenic
945224760 2:207522235-207522257 GATTTATTGGCTGGGTATGGTGG - Intergenic
947372457 2:229462640-229462662 AATTGGTTGTAGGGGTAAGATGG - Intronic
947908526 2:233785227-233785249 AGTTTATTGGCTGGGTATGGTGG + Intronic
1169458320 20:5772622-5772644 AATTTTTTGGGTGGGTATGGTGG + Intronic
1170222415 20:13954074-13954096 AAGTTTTTGTCGGGGAATGGAGG + Intronic
1170354970 20:15481986-15482008 TATTTATTTTGGAGGTATGGAGG + Intronic
1171504098 20:25619274-25619296 AATTTATTAGCTGGGTATGGTGG - Intronic
1171563718 20:26156267-26156289 AATTTTTTGTATGGGTTTTGGGG + Intergenic
1172906041 20:38370084-38370106 AATTTACTGTCTGGGTGTGGTGG + Intronic
1173375577 20:42479603-42479625 AATTTATTGCAGATGTTTGGTGG + Intronic
1173990965 20:47303147-47303169 AATTTATTGTAGGGGTATGGGGG + Intronic
1180649954 22:17369484-17369506 ATTATATTGTAGGGGACTGGGGG + Exonic
1181017253 22:20078328-20078350 ATTTTTTTGTAGGGGGTTGGGGG + Intergenic
1183896772 22:40975670-40975692 AATTTCTTGGAGGGCTATAGAGG + Intergenic
949825855 3:8164887-8164909 AATTTTTTGTAGGGAGGTGGTGG - Intergenic
952368256 3:32694087-32694109 AATATATTGTTGGGGTTTGGTGG + Intronic
956686532 3:71833931-71833953 AATTTATTGGCCGGGCATGGTGG + Intergenic
958816776 3:98925147-98925169 AATTTATTGTCTGGCCATGGTGG + Intergenic
963307824 3:143673541-143673563 AATTTATGGTTGGGGTAGGATGG + Intronic
963501837 3:146137397-146137419 AATTTATTAGCGGGGTTTGGTGG - Intronic
964153959 3:153562846-153562868 AATGTATAGTAGAGGAATGGAGG + Intergenic
965681245 3:171253653-171253675 AATTTATTGTAGGGTCTTGATGG - Intronic
965927602 3:174001539-174001561 AATGTATTGTAGGGGTTAAGAGG + Intronic
966056181 3:175693302-175693324 AATTTAGTGTAGGGGAATTTAGG - Intronic
966274373 3:178147071-178147093 CATTTATTGTATTTGTATGGTGG + Intergenic
966586557 3:181632866-181632888 AATTTATTGGCTGGGCATGGTGG - Intergenic
966959077 3:184915523-184915545 AATTTTTTGGCGGGGTGTGGTGG + Intronic
968796160 4:2706259-2706281 AATTTATTGTAGGACAAAGGTGG - Intronic
970382482 4:15522024-15522046 TATTTTTTGTAGAGGTAGGGGGG - Intronic
970844719 4:20522883-20522905 GATTTACTGTGGGGGTAGGGAGG + Intronic
972274999 4:37549083-37549105 AACTTAGTGTTGGGGCATGGAGG - Intronic
974045370 4:56893971-56893993 AATTCATTGGAGGGATGTGGTGG - Intergenic
974468598 4:62290665-62290687 AATTTATTCTGGGGGTAGAGTGG + Intergenic
974796382 4:66756412-66756434 AAATTATTATCTGGGTATGGAGG - Intergenic
974887620 4:67839976-67839998 AATTTGTTGTCGGGGGAGGGGGG - Intronic
975019774 4:69471975-69471997 AATTCAATGGAGGGGCATGGTGG + Intergenic
977811069 4:101356652-101356674 GGTTTATTGTAAGGGTATTGAGG - Intergenic
978176811 4:105741945-105741967 AAAATTATGTAGGGGTATGGAGG + Intronic
979525187 4:121708729-121708751 AATTCTTTGTTGGGGAATGGGGG + Intergenic
979531159 4:121770300-121770322 AATTTACTGGAGGGGTATGTGGG + Intergenic
981330181 4:143499470-143499492 AATTAATTGTAAGGGTATTGGGG - Intergenic
981639040 4:146913729-146913751 ATTTTATTGAAAGGTTATGGTGG - Intronic
982813884 4:159861518-159861540 AATTAAATGTTGGGGTATGAAGG - Intergenic
982952943 4:161723284-161723306 AATTTGTTGTCAGAGTATGGAGG + Intronic
985018115 4:185658831-185658853 AATTTTTTGTACAGGCATGGTGG - Intronic
987978367 5:25045435-25045457 GCTTTATTGCAGTGGTATGGAGG + Intergenic
988025585 5:25683869-25683891 AATCTATTGTATCTGTATGGTGG + Intergenic
988059326 5:26147147-26147169 AATTTTTTGCAGGGGTAAAGAGG - Intergenic
988625357 5:32869304-32869326 ATTTTATTGTATGGGTAGTGGGG + Intergenic
992968330 5:82027109-82027131 AATTTATTGGCAGGGCATGGTGG + Intronic
996531968 5:124535858-124535880 AATTTATTGGCTGGGTGTGGTGG - Intergenic
996827262 5:127699255-127699277 AATTTATTGTTGGCATATTGGGG + Intergenic
998126212 5:139623976-139623998 AAGTTTTTGTATGGGTGTGGTGG - Intronic
998850822 5:146349003-146349025 AATTCACTGAAGGGGTATGTAGG - Intergenic
999186485 5:149714377-149714399 CATTCATTGAGGGGGTATGGGGG - Intergenic
999562144 5:152815616-152815638 AATTTACTTTAGGGATGTGGTGG - Intergenic
1001884510 5:175277374-175277396 AATGAATTATAGAGGTATGGGGG - Intergenic
1003509456 6:6767463-6767485 AATTTATTGGCCGGGTGTGGTGG - Intergenic
1004360144 6:14963800-14963822 ATTTTATTGGATGGGTGTGGTGG - Intergenic
1005751055 6:28883185-28883207 AATTTTTTGTAGAGATGTGGGGG + Intergenic
1005755409 6:28921397-28921419 AATTTATATTAGGGGTATATGGG - Intronic
1006268337 6:32944284-32944306 AATGTATTGGGGGGGTGTGGGGG - Intronic
1006925119 6:37649703-37649725 AATCTATTATAGGGCTGTGGGGG + Intronic
1009594247 6:65714067-65714089 AAGTTATTTTAGGGGGATTGTGG - Intergenic
1013758455 6:113487943-113487965 AATATATTGTAAGGGAATAGGGG + Intergenic
1014691270 6:124566236-124566258 ATTTTGTGGTTGGGGTATGGTGG - Intronic
1016815254 6:148297544-148297566 AAATTATTGTCCGGGTGTGGCGG + Intronic
1018380368 6:163253495-163253517 AATTTATTTTAGGGGTAGGAGGG + Intronic
1021181513 7:17511425-17511447 AAGCTATTTTAGGGGTATAGTGG + Intergenic
1025823712 7:64994376-64994398 AATATATTGAAGGAGGATGGTGG - Intronic
1026252978 7:68686908-68686930 AATTTTTTGGCTGGGTATGGTGG - Intergenic
1026309062 7:69167971-69167993 CATTTCTTGTAGGCTTATGGAGG - Intergenic
1027751438 7:82152263-82152285 AATTTATTTTTGGGGGGTGGGGG - Intronic
1029060718 7:97795409-97795431 AATTTATTGGTCGGGTGTGGTGG - Intergenic
1029172146 7:98638683-98638705 AATTTAAGGTAGGGCAATGGAGG + Intergenic
1029442702 7:100595924-100595946 AATTTAGTGAAGGGGTAGGGTGG + Intronic
1030242204 7:107340482-107340504 AATTTTTTTTAGGGGGATTGGGG - Intronic
1030445335 7:109642208-109642230 ATTTTTTTGTGGTGGTATGGAGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035291664 7:157843377-157843399 AATTAATTGTGGTGGTAGGGGGG + Intronic
1036572087 8:9989274-9989296 AATGTATTGTCTGGGTGTGGTGG + Intergenic
1037325843 8:17689255-17689277 AATTATTTGTAGGGGGAGGGAGG + Intronic
1037355234 8:18012145-18012167 AAATTATTGGATGGGTGTGGTGG - Intronic
1038055646 8:23855153-23855175 AATGGATAGCAGGGGTATGGTGG + Intergenic
1042259303 8:66840668-66840690 AATTTATTGGCCGGGTGTGGTGG + Intronic
1043053942 8:75413579-75413601 AAATTATTGGCTGGGTATGGTGG + Intronic
1044529603 8:93292254-93292276 AATTTATTATAGGGGTTGGTTGG - Intergenic
1045190632 8:99879499-99879521 TATTTTTTGTGGGGGTTTGGGGG - Intronic
1045228115 8:100271881-100271903 AATTGATTCTTGGGGAATGGGGG - Intronic
1045754278 8:105523794-105523816 AATTTATTTTTGTGGTATGTTGG + Intronic
1046760243 8:118012888-118012910 AATTTGTTGTAGCAGAATGGTGG + Intronic
1046781812 8:118223458-118223480 AATGTTCTGTAGGAGTATGGTGG + Intronic
1051481044 9:17561828-17561850 AATTTTTTGTACAGGCATGGTGG - Intergenic
1052301938 9:26961865-26961887 AATTAAATGTAAGGGTATGATGG + Intronic
1053078040 9:35151662-35151684 AATTTTTGGGAGTGGTATGGAGG + Intergenic
1055604714 9:77956707-77956729 AACTAACTGTAGGGGCATGGAGG + Intronic
1056220426 9:84446193-84446215 AATCGACTGTAAGGGTATGGTGG + Intergenic
1056339820 9:85616618-85616640 AATTAATTTTATTGGTATGGTGG - Intronic
1059594935 9:115709393-115709415 AAATTATTGCAGGAGTAAGGTGG + Intergenic
1060550167 9:124481252-124481274 AATTTATTCCAGGGCTGTGGGGG + Exonic
1062336564 9:136073138-136073160 AATTAATTGGCCGGGTATGGTGG + Intronic
1187279719 X:17848696-17848718 AAATAAGTGTAGGGGCATGGAGG + Intronic
1189665240 X:43348271-43348293 CATTTATTGTAGGGCTATTCTGG + Intergenic
1190770041 X:53506532-53506554 AATTAATTTTATGGGCATGGTGG + Intergenic
1192884528 X:75322824-75322846 CCTTTCTTGTAGGGGTAAGGTGG + Intergenic
1197199570 X:123736261-123736283 AATTTTTTGTGGGGATAGGGGGG + Intergenic
1197804494 X:130385887-130385909 AATTTAATGTCAAGGTATGGAGG - Intergenic
1201760976 Y:17537726-17537748 AATTTGGTGTTTGGGTATGGGGG + Intergenic
1201840576 Y:18368264-18368286 AATTTGGTGTTTGGGTATGGGGG - Intergenic