ID: 1173991210

View in Genome Browser
Species Human (GRCh38)
Location 20:47305039-47305061
Sequence CTTGCTGCCCAGGCTGGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2309
Summary {0: 1, 1: 0, 2: 15, 3: 370, 4: 1923}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173991210_1173991217 28 Left 1173991210 20:47305039-47305061 CCGCGACCAGCCTGGGCAGCAAG 0: 1
1: 0
2: 15
3: 370
4: 1923
Right 1173991217 20:47305090-47305112 AAAAATTAGCCAGGCATGTTGGG 0: 7
1: 533
2: 1398
3: 2853
4: 3691
1173991210_1173991215 19 Left 1173991210 20:47305039-47305061 CCGCGACCAGCCTGGGCAGCAAG 0: 1
1: 0
2: 15
3: 370
4: 1923
Right 1173991215 20:47305081-47305103 TTAAAAAAAAAAAATTAGCCAGG 0: 114
1: 790
2: 16458
3: 138945
4: 291236
1173991210_1173991216 27 Left 1173991210 20:47305039-47305061 CCGCGACCAGCCTGGGCAGCAAG 0: 1
1: 0
2: 15
3: 370
4: 1923
Right 1173991216 20:47305089-47305111 AAAAAATTAGCCAGGCATGTTGG 0: 195
1: 15970
2: 74623
3: 145197
4: 199559
1173991210_1173991218 29 Left 1173991210 20:47305039-47305061 CCGCGACCAGCCTGGGCAGCAAG 0: 1
1: 0
2: 15
3: 370
4: 1923
Right 1173991218 20:47305091-47305113 AAAATTAGCCAGGCATGTTGGGG 0: 7
1: 420
2: 1072
3: 2126
4: 2622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173991210 Original CRISPR CTTGCTGCCCAGGCTGGTCG CGG (reversed) Intronic
Too many off-targets to display for this crispr