ID: 1173991319

View in Genome Browser
Species Human (GRCh38)
Location 20:47305872-47305894
Sequence GTAAAGACCCTGACGTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173991319 Original CRISPR GTAAAGACCCTGACGTCATT TGG Intronic
902046402 1:13527979-13528001 GGAAAGACCCTGTCCTCATGAGG - Intergenic
911173672 1:94796776-94796798 GTAAAGACCCTGGCCTCAAGTGG - Intergenic
911717089 1:101145306-101145328 ATAAATACCCTGACCACATTTGG + Intergenic
919971395 1:202581906-202581928 GGCAAGACCCAGAGGTCATTAGG + Exonic
1075273669 10:121075121-121075143 GCAAAGACCCTGAGGTCAGTTGG + Intergenic
1078504326 11:11920570-11920592 GTAATAACACTGATGTCATTTGG + Intronic
1081162422 11:39766282-39766304 CTAAGGACCTTGACGTCAGTAGG - Intergenic
1090541707 11:127712980-127713002 GTAAAGAGGCTGACGCTATTTGG + Intergenic
1100713478 12:97281913-97281935 GTAATAACCTTGAAGTCATTTGG + Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101892196 12:108727037-108727059 GGAAAGATCCTGAGGTCAGTGGG - Intronic
1105335572 13:19464442-19464464 ATAAAGACCCTTACCTCAATTGG + Exonic
1113636637 13:111923415-111923437 GTAATCACCCTGATGTCATGTGG - Intergenic
1120519994 14:85516050-85516072 GCAATGACCCTGCTGTCATTGGG + Intergenic
1126451716 15:48815759-48815781 GTAAAGACCATGACTTCCTGGGG - Intergenic
1126465210 15:48955489-48955511 GAAATGACCCTAAGGTCATTAGG + Intronic
1131143811 15:89999498-89999520 GCAAAGGCCCTGGGGTCATTGGG + Intergenic
1131569110 15:93515515-93515537 GAAAAGACCTTGAGGACATTTGG - Intergenic
1138707596 16:58933378-58933400 GTACAGTGGCTGACGTCATTTGG - Intergenic
1139692081 16:68647449-68647471 TTAAAATGCCTGACGTCATTGGG - Intronic
1139713145 16:68791765-68791787 GCAAAGTCCCTGACCTCATGGGG - Intronic
1142803196 17:2357909-2357931 GTGATGACCCTGACATTATTTGG - Intronic
1157665307 18:49481256-49481278 GTTAGGACCCAGACTTCATTAGG + Exonic
937387169 2:121445771-121445793 GTAAAAGCCCTCACGTCTTTTGG - Intronic
942093436 2:172515929-172515951 GTTATGACCCTGATGTCATCAGG + Intergenic
942493700 2:176516487-176516509 ATAAAGAGCCTGACTCCATTTGG - Intergenic
943383305 2:187175505-187175527 GCAAAGACCCTGATGTCAGGAGG - Intergenic
946193177 2:218018320-218018342 GTGAAGACTCAGACCTCATTTGG - Intergenic
948742186 2:240055365-240055387 GCAGAGACCCTGAGGTCATCAGG + Intergenic
1172212233 20:33208604-33208626 ATAAAGTCCCTGACTTCATGAGG - Intergenic
1173991319 20:47305872-47305894 GTAAAGACCCTGACGTCATTTGG + Intronic
1180651417 22:17380371-17380393 TTAAAGTCCCTGACCTCATGTGG + Intronic
1180935249 22:19621117-19621139 TTAAAGACTCGGACTTCATTAGG + Intergenic
1183143254 22:35964625-35964647 GTATAGATCCTGACTGCATTAGG - Intronic
955397818 3:58569513-58569535 GTAAAGACCCTGTCCCCAGTGGG - Intronic
955557055 3:60149643-60149665 GCAACAACCCTGACATCATTTGG + Intronic
957522359 3:81335867-81335889 GAAAAAACATTGACGTCATTTGG - Intergenic
960121479 3:113951660-113951682 GGAAGGACCCTGAAGGCATTCGG - Intronic
963035865 3:141028239-141028261 GTAAAGACCCAGAGGTCAGAGGG + Intergenic
964045465 3:152319411-152319433 ATAAAGATCTTGAGGTCATTAGG + Intronic
965662378 3:171055246-171055268 GTTAAGACCCAAATGTCATTAGG + Intergenic
969936729 4:10689494-10689516 GTAAACACCCTGACACTATTCGG + Intergenic
970918655 4:21366979-21367001 TTAAAGACCCTGATCTCATGAGG - Intronic
974691859 4:65306604-65306626 GTAAAGCCCCTGAAGTCATGTGG + Intergenic
976200832 4:82577142-82577164 GAAAAGACCCTGATTTCAGTGGG + Intergenic
979160980 4:117460925-117460947 ATAAAAACCTTGACGACATTTGG - Intergenic
982681048 4:158431266-158431288 GAAAAGACCCTGACATGATATGG + Intronic
989028241 5:37090420-37090442 GTTATGACCCTGATGTCATCAGG + Intergenic
990005971 5:50944884-50944906 GTAAAGAGCTTGGCTTCATTGGG + Intergenic
994322621 5:98410820-98410842 CTAAAGACCTTGACGCCAGTAGG + Intergenic
998512415 5:142724543-142724565 GTAAAGGAATTGACGTCATTTGG - Intergenic
1003146021 6:3511442-3511464 ATTATGACCCTGGCGTCATTAGG - Intergenic
1012272958 6:97237243-97237265 CTAGTGACCCTGACGTTATTGGG - Intronic
1015530088 6:134212982-134213004 TTGAAGACCCTGACTTCATCAGG - Intronic
1017299333 6:152837111-152837133 GAAAGGCCCCTGACTTCATTGGG + Intergenic
1017494106 6:154968083-154968105 GCAAACACCCTGACCTCATGTGG - Intronic
1017989646 6:159475016-159475038 GCAAAGAGCCTGAGATCATTGGG + Intergenic
1019663349 7:2238368-2238390 CTGAAGACACTGTCGTCATTGGG - Intronic
1021498624 7:21304562-21304584 GTAAAGACCATAATGTCAATTGG + Intergenic
1022356627 7:29621657-29621679 ATAAAGACCCTGTAGTTATTAGG - Intergenic
1023091909 7:36625288-36625310 GTAAAGACTCTGGAGTCAGTTGG + Intronic
1023324367 7:39037092-39037114 TTAAAGACCCTGAGGCCTTTTGG + Intronic
1025086360 7:56026736-56026758 GTAAAGACCTTGAAGTCAGCAGG + Intronic
1036117283 8:5972072-5972094 GGAAAGAACCTGAGGACATTGGG - Intergenic
1036228953 8:6983454-6983476 ATAAAAACCTTGACATCATTAGG + Intergenic
1036231404 8:7002559-7002581 ATAAAAACCTTGACATCATTAGG + Intronic
1036233862 8:7021655-7021677 ATAAAAACCTTGACATCATTAGG + Intergenic
1037209379 8:16367251-16367273 GTGAATACCCTGACATCTTTGGG - Intronic
1042453062 8:68972181-68972203 TTAAAGACACTGACATGATTTGG - Intergenic
1045650444 8:104337308-104337330 GTTCAGGCCCTGACTTCATTTGG + Intronic
1058181637 9:101807215-101807237 GCAAAGACACTGGCATCATTTGG + Intergenic
1194486607 X:94493979-94494001 GTTATGACCCTGATGTCATCAGG + Intergenic
1194666146 X:96679620-96679642 GTAAAATCCCTGCCATCATTAGG - Intergenic
1200824515 Y:7624047-7624069 GTTATGACCCTGATGTCATCAGG - Intergenic
1201054731 Y:9977284-9977306 GTTATGACCCTGATGTCATCAGG + Intergenic
1202106488 Y:21373514-21373536 GTAAAGAAACTGACGTGAATTGG - Intergenic
1202235540 Y:22707040-22707062 GTTATGACCCTGATGTCATCAGG + Intergenic
1202307619 Y:23489128-23489150 GTTATGACCCTGATGTCATCAGG - Intergenic
1202563182 Y:26181458-26181480 GTTATGACCCTGATGTCATCAGG + Intergenic