ID: 1173995024

View in Genome Browser
Species Human (GRCh38)
Location 20:47331390-47331412
Sequence GGGAATGAGTCCATATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173995024 Original CRISPR GGGAATGAGTCCATATCTCT GGG Intronic
901260646 1:7868318-7868340 CTGGATGAGTCCTTATCTCTGGG - Intergenic
902631496 1:17707195-17707217 GGTATTGAGTCCATAGCCCTGGG - Intergenic
905401543 1:37707191-37707213 GGGTAAGAGTCAAAATCTCTTGG - Intronic
906065212 1:42975574-42975596 GTGAATGAGTTCACCTCTCTGGG + Intergenic
906463550 1:46056437-46056459 GGGAATGAATCCTTACCTCCAGG - Intronic
907959832 1:59268530-59268552 TGGAAAGAGTCGATATCTATTGG - Intergenic
911408467 1:97471334-97471356 GGGAAGGAGACCAAATATCTTGG + Intronic
911749108 1:101475897-101475919 GGGAATGAGCTCTTTTCTCTTGG + Intergenic
912418885 1:109530254-109530276 AGCCATGAGTCCATCTCTCTGGG + Intergenic
912822667 1:112880187-112880209 GGGAATGAGTTGGTATCTCTTGG - Intergenic
913259628 1:116986682-116986704 AGGAATGAGACCTTATCTCTCGG + Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
919989134 1:202696986-202697008 GTGAATGAGACCATGTGTCTGGG - Intronic
922097420 1:222454357-222454379 TGAAATGAGTTCACATCTCTTGG - Intergenic
923953676 1:238990249-238990271 GGGAAAGAGTGGATATCTTTAGG + Intergenic
924170301 1:241332484-241332506 GGGAAGGAGTCCACATCTTCAGG - Intronic
1065779587 10:29154678-29154700 GGGAATTGCTCCATTTCTCTTGG - Intergenic
1066333771 10:34454985-34455007 GGGAATGAGCCTCTATCTCAAGG - Intronic
1066977425 10:42381914-42381936 GGCAATGAGGCCATTTCACTGGG + Intergenic
1069050218 10:63784773-63784795 GGGAATTAATCCATTTCTCATGG + Intergenic
1069931829 10:71888061-71888083 GGCATTGAGTCAGTATCTCTGGG - Intergenic
1070005330 10:72418802-72418824 GGTTACGAGTCCATCTCTCTAGG - Intronic
1072205251 10:93198293-93198315 GGGATTGAACCCATATCTCCTGG - Intergenic
1072322298 10:94262616-94262638 GGGATTGAGAGCACATCTCTGGG + Exonic
1073029692 10:100515796-100515818 AGGAAGGAGCCAATATCTCTGGG + Intronic
1078721250 11:13885225-13885247 GGAAATGAGTCCATTCCTCCAGG + Intergenic
1081681071 11:45003355-45003377 GGGCATGTTTCCATTTCTCTTGG + Intergenic
1083040362 11:59680073-59680095 GGGAATGAGGCCATTTCCCCAGG - Intergenic
1087595170 11:100244388-100244410 GGAATTCACTCCATATCTCTTGG - Intronic
1088709601 11:112496094-112496116 GGAAATGAGTCCATTTGTTTTGG - Intergenic
1089343810 11:117777579-117777601 GAGACTGTGTCCATGTCTCTAGG - Intronic
1089939892 11:122405163-122405185 GGGAATTAGTCCATTCCTATGGG + Intergenic
1093990026 12:25579711-25579733 AAGAATGAGTCCAAAGCTCTTGG - Intronic
1095950977 12:47781814-47781836 GGGACAGAGTCAGTATCTCTGGG + Exonic
1097908106 12:64941397-64941419 GGGAATGTGGACATATCTTTTGG - Intergenic
1101806957 12:108072501-108072523 GGGACTGAGTCCAGATCTCCTGG - Intergenic
1109119973 13:58442993-58443015 AGGAATGATTCAATATCCCTGGG - Intergenic
1113531290 13:111029417-111029439 GGGAAGGAGTCCACTTCCCTTGG - Intergenic
1117870591 14:60196711-60196733 GGGTATAAGTTCATTTCTCTGGG - Intergenic
1119883468 14:78120986-78121008 GAGAATGGGTGCATATATCTAGG - Intergenic
1125777420 15:42229600-42229622 GGGACTGAGTGTAGATCTCTGGG - Intronic
1127842610 15:62844052-62844074 GGGAATGTCTCCAAATTTCTTGG - Exonic
1134024801 16:10945456-10945478 GGGAATGACTCTACAGCTCTGGG + Intronic
1134755076 16:16660001-16660023 GGGACTGAGTCCTTATCTTGTGG - Intergenic
1134990987 16:18699172-18699194 GGGACTGAGTCCTTATCTTGTGG + Intergenic
1136373550 16:29850909-29850931 GGAAATGAGTCCAGAGCTCTTGG - Intergenic
1144582845 17:16469552-16469574 GGGACTGAGTCCACCTCTCAGGG + Intronic
1146835174 17:36104902-36104924 AGGAATCGGTCCATATCTCATGG - Intronic
1146849788 17:36212148-36212170 AGGAATTGGTCCATATCTCACGG - Intronic
1147679040 17:42227819-42227841 GGCATTGAGTCCATTTCTGTTGG - Intronic
1148331090 17:46814471-46814493 GGAAATTAGTCCAGGTCTCTTGG - Intronic
1149795392 17:59514354-59514376 GGGCATGCGGCCAAATCTCTTGG + Intergenic
1157584808 18:48794195-48794217 GGTATTGACTGCATATCTCTAGG - Intronic
1164082699 19:21874442-21874464 GGGAATGTTTATATATCTCTGGG + Intergenic
1164190669 19:22914493-22914515 GGCAATGTTTACATATCTCTGGG + Intergenic
1164340614 19:24394136-24394158 GGTAATGGGTTCATATCACTAGG + Intergenic
1164903190 19:31945821-31945843 GGGCATGAGGCCCAATCTCTAGG - Intergenic
1167344994 19:48939734-48939756 GGGAATGATTCTGTCTCTCTGGG + Intronic
1168726188 19:58583394-58583416 TGGAATGAGCCCATATCCGTGGG - Intergenic
927374500 2:22397792-22397814 GGCAATGAGTCCAAATATCTAGG + Intergenic
931580412 2:63765635-63765657 GGGATTGAATCCATGTCTTTGGG - Intronic
933470635 2:82718989-82719011 AGAAATAAGTCCATATCGCTGGG + Intergenic
934899993 2:98152071-98152093 GGAAATGAGTCCATCTGTCAAGG + Intronic
935408355 2:102733596-102733618 GGGTCTGAGTCCATTTCTTTTGG + Intronic
935521780 2:104115513-104115535 GGGAATAAGCCCATAAATCTTGG - Intergenic
936507117 2:113116579-113116601 GGGAATGAGTCCAGGTCTGCAGG + Intronic
937955745 2:127420899-127420921 GGGCTTGAGTACTTATCTCTGGG + Intronic
939274703 2:139986028-139986050 AGGAATGGGTCCATTTCTTTTGG + Intergenic
939646332 2:144703824-144703846 GGTAATGAGTCCTGATCTTTTGG - Intergenic
939715012 2:145572805-145572827 AGGAATGACTCCAAATCTTTTGG + Intergenic
940898134 2:159100993-159101015 GGGAGTGGCTCCATACCTCTGGG - Intronic
943463565 2:188199841-188199863 GGGAATGAGTCATTAACTCGTGG - Intergenic
945498945 2:210544218-210544240 GGGAATCAGTCCATGTCAGTAGG + Intronic
946829048 2:223708911-223708933 GGGAATTTGCCCATATCCCTGGG - Intergenic
947990115 2:234480313-234480335 TGGAATCAGTGCATATTTCTGGG + Intergenic
1172743316 20:37186363-37186385 GGAAATGACTCCAAATCTGTAGG + Intronic
1173203751 20:40974438-40974460 CCGAATGAATCCATATATCTAGG - Intergenic
1173318932 20:41970081-41970103 GGGGATGGGTACATTTCTCTAGG + Intergenic
1173995024 20:47331390-47331412 GGGAATGAGTCCATATCTCTGGG + Intronic
1176281996 20:64318592-64318614 GGCATTGTGGCCATATCTCTGGG - Intergenic
949712326 3:6885595-6885617 GGGAATAAATCCATATTTCTGGG - Intronic
956267830 3:67417688-67417710 GGGAAAGAGTACACATCTGTGGG - Intronic
956362545 3:68464495-68464517 GAAAATGAGTCCATAACTCTTGG + Intronic
957801782 3:85093877-85093899 GGGAAGGAGTCCATTCCTGTGGG + Intronic
961708305 3:128807057-128807079 GTGACTTAGTCCTTATCTCTTGG + Intronic
963326021 3:143863936-143863958 GTGAATGTGTCCTTCTCTCTGGG + Intergenic
964240387 3:154585884-154585906 GGGACTGAGTCCTCATCTGTGGG + Intergenic
965121429 3:164562669-164562691 GGAAATGATTCGATATCTTTTGG - Intergenic
967934775 3:194718244-194718266 GAGAATGAGTTCACATCTCCTGG + Intergenic
969106317 4:4809527-4809549 ATGTATGAGTCCACATCTCTGGG + Intergenic
970196570 4:13556919-13556941 GGGAAAGAGTCCTTCACTCTGGG + Intergenic
971082468 4:23230035-23230057 GGGAATGGGTTCATTTTTCTAGG - Intergenic
971519817 4:27535048-27535070 GTGAATGTGTGCATTTCTCTTGG - Intergenic
971636324 4:29063581-29063603 GGAACTGAGTCCATATTTATGGG - Intergenic
971842618 4:31873637-31873659 GGGAATGACTAGAGATCTCTAGG - Intergenic
972174668 4:36388788-36388810 AGGTATGAGTCCAAATCTCACGG + Intergenic
973631315 4:52823519-52823541 GAGAAGGAGTCCATATCACTGGG + Intergenic
976805357 4:89040259-89040281 GGGAATGAGTACAAATATCACGG + Intronic
977912524 4:102554652-102554674 GGGAATGACAGCATGTCTCTAGG + Intronic
985429467 4:189865055-189865077 GGGATGGAGTCCTTCTCTCTGGG - Intergenic
987129501 5:14847691-14847713 GAGACTGGGTCCATATCTATAGG - Intronic
990657681 5:57975550-57975572 TGGAATGAGTGAAGATCTCTGGG + Intergenic
995258802 5:110077374-110077396 GAGAGTGAGATCATATCTCTTGG + Intergenic
995571956 5:113490062-113490084 TGGAACAAGTCCATATGTCTTGG + Intergenic
996341323 5:122441935-122441957 GGGAATAAATCCATATATGTCGG - Intronic
998064610 5:139147926-139147948 GGGGAGGAGCCCATATCCCTGGG + Intronic
1000063399 5:157675411-157675433 GAGAAAGACTCCATGTCTCTTGG + Intronic
1000745801 5:165031849-165031871 TAGAATGAGACCAGATCTCTTGG - Intergenic
1000981336 5:167820109-167820131 GGGAAAGAGTCCTTTTCCCTGGG + Intronic
1005857040 6:29870538-29870560 GAGGAGGAGTCCATATCTCTAGG + Intergenic
1005862861 6:29914689-29914711 GAGGAGGAGTCCATATCCCTAGG + Intergenic
1005874362 6:29999887-29999909 GAGGAGGAGTCCATATCCCTAGG + Intergenic
1008081208 6:47196108-47196130 GGAAATGTGTCCATGTGTCTTGG - Intergenic
1010015694 6:71103421-71103443 GGGAATGTGGCCATATCTGGGGG - Intergenic
1012132740 6:95517781-95517803 GGGAGTGAGGCCATTGCTCTGGG - Intergenic
1012629649 6:101448486-101448508 GGAAATCAGTTCATTTCTCTGGG + Intronic
1021615699 7:22500586-22500608 GGGAATGCTTCCATATCTCATGG - Intronic
1022160636 7:27707503-27707525 GGGAATCAGTCATTATCTTTGGG + Intergenic
1024446066 7:49480554-49480576 GGGAATGTGTTTATCTCTCTGGG + Intergenic
1024497052 7:50060557-50060579 CGGAATGTATCCATTTCTCTAGG - Intronic
1028376799 7:90154049-90154071 GGGAATGCTTCCATATCTCATGG + Intergenic
1032737493 7:134705858-134705880 GGTAATGTGTCCAGATCCCTTGG + Intergenic
1033743915 7:144295285-144295307 TAGAATGAGTGCATATCTCAGGG + Intergenic
1037185851 8:16062948-16062970 GTGTATGAGTCCATTTCTCACGG + Intergenic
1037500483 8:19480904-19480926 GGGAATGAGTCGATATTGCCTGG - Intronic
1046500242 8:115067256-115067278 GGAAATTAGACCATATCTTTTGG - Intergenic
1047990201 8:130278248-130278270 GGTATTGAGTCCAGATCTTTAGG + Intronic
1049505224 8:142992628-142992650 GGAGATGAGTCCATAGCTCAAGG - Intergenic
1049652299 8:143776695-143776717 GGGATCGTGTCCATGTCTCTAGG - Intergenic
1050146968 9:2579055-2579077 GATAATTAGTCCATATCTCCTGG - Intergenic
1052047587 9:23812436-23812458 GGGAATGACTCCCAATCTTTAGG + Intronic
1052823384 9:33157253-33157275 GTGAATGATTCCAAACCTCTTGG + Intronic
1055005501 9:71501031-71501053 GGGAATGAGATCATATCCTTTGG + Intergenic
1057140387 9:92723220-92723242 GGGCATGTGTACATTTCTCTGGG - Intronic
1059447446 9:114347626-114347648 GTGCCTGAGTCCATATGTCTGGG + Intronic
1060113124 9:120920701-120920723 GGTAATCAGTCCATGGCTCTGGG + Intronic
1062599468 9:137313417-137313439 GGGAATGAGCCCAGGTCCCTCGG + Intronic
1187730500 X:22248665-22248687 GGGAATGAGGACATATCTTTAGG + Exonic
1188120377 X:26298735-26298757 GGGAGTGAGTTGATATTTCTTGG - Intergenic
1193003032 X:76583865-76583887 GGTACTGGGTCCATGTCTCTAGG - Intergenic
1193003774 X:76592274-76592296 AGGAATTTGTCCATATTTCTAGG + Intergenic
1198250611 X:134876116-134876138 GGGAATCACTTCATCTCTCTGGG - Intergenic
1201498892 Y:14620068-14620090 GGGAATGAGGCCTTGTATCTGGG + Intronic
1202268319 Y:23044280-23044302 GGGAATCATGACATATCTCTGGG + Intergenic
1202421311 Y:24678024-24678046 GGGAATCATGACATATCTCTGGG + Intergenic
1202449475 Y:24992058-24992080 GGGAATCATGACATATCTCTGGG - Intergenic