ID: 1173999342

View in Genome Browser
Species Human (GRCh38)
Location 20:47362938-47362960
Sequence TCTTGATGTGGGGAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173999342_1173999347 14 Left 1173999342 20:47362938-47362960 CCTCTCTCTTCCCCACATCAAGA No data
Right 1173999347 20:47362975-47362997 GTGATTGAGTGTGTGGCTGCTGG No data
1173999342_1173999348 29 Left 1173999342 20:47362938-47362960 CCTCTCTCTTCCCCACATCAAGA No data
Right 1173999348 20:47362990-47363012 GCTGCTGGTGCCACACTCTCTGG No data
1173999342_1173999349 30 Left 1173999342 20:47362938-47362960 CCTCTCTCTTCCCCACATCAAGA No data
Right 1173999349 20:47362991-47363013 CTGCTGGTGCCACACTCTCTGGG No data
1173999342_1173999346 7 Left 1173999342 20:47362938-47362960 CCTCTCTCTTCCCCACATCAAGA No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173999342 Original CRISPR TCTTGATGTGGGGAAGAGAG AGG (reversed) Intergenic
No off target data available for this crispr