ID: 1173999345

View in Genome Browser
Species Human (GRCh38)
Location 20:47362950-47362972
Sequence CACAGTTGTGCTTCTTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173999345_1173999349 18 Left 1173999345 20:47362950-47362972 CCACATCAAGAAGCACAACTGTG No data
Right 1173999349 20:47362991-47363013 CTGCTGGTGCCACACTCTCTGGG No data
1173999345_1173999347 2 Left 1173999345 20:47362950-47362972 CCACATCAAGAAGCACAACTGTG No data
Right 1173999347 20:47362975-47362997 GTGATTGAGTGTGTGGCTGCTGG No data
1173999345_1173999348 17 Left 1173999345 20:47362950-47362972 CCACATCAAGAAGCACAACTGTG No data
Right 1173999348 20:47362990-47363012 GCTGCTGGTGCCACACTCTCTGG No data
1173999345_1173999346 -5 Left 1173999345 20:47362950-47362972 CCACATCAAGAAGCACAACTGTG No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data
1173999345_1173999350 23 Left 1173999345 20:47362950-47362972 CCACATCAAGAAGCACAACTGTG No data
Right 1173999350 20:47362996-47363018 GGTGCCACACTCTCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173999345 Original CRISPR CACAGTTGTGCTTCTTGATG TGG (reversed) Intergenic
No off target data available for this crispr