ID: 1173999346

View in Genome Browser
Species Human (GRCh38)
Location 20:47362968-47362990
Sequence CTGTGCAGTGATTGAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173999340_1173999346 21 Left 1173999340 20:47362924-47362946 CCTGTAACCTTTTTCCTCTCTCT No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data
1173999341_1173999346 14 Left 1173999341 20:47362931-47362953 CCTTTTTCCTCTCTCTTCCCCAC No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data
1173999345_1173999346 -5 Left 1173999345 20:47362950-47362972 CCACATCAAGAAGCACAACTGTG No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data
1173999344_1173999346 -4 Left 1173999344 20:47362949-47362971 CCCACATCAAGAAGCACAACTGT No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data
1173999343_1173999346 -3 Left 1173999343 20:47362948-47362970 CCCCACATCAAGAAGCACAACTG No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data
1173999342_1173999346 7 Left 1173999342 20:47362938-47362960 CCTCTCTCTTCCCCACATCAAGA No data
Right 1173999346 20:47362968-47362990 CTGTGCAGTGATTGAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173999346 Original CRISPR CTGTGCAGTGATTGAGTGTG TGG Intergenic
No off target data available for this crispr