ID: 1173999350

View in Genome Browser
Species Human (GRCh38)
Location 20:47362996-47363018
Sequence GGTGCCACACTCTCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173999345_1173999350 23 Left 1173999345 20:47362950-47362972 CCACATCAAGAAGCACAACTGTG No data
Right 1173999350 20:47362996-47363018 GGTGCCACACTCTCTGGGTGTGG No data
1173999343_1173999350 25 Left 1173999343 20:47362948-47362970 CCCCACATCAAGAAGCACAACTG No data
Right 1173999350 20:47362996-47363018 GGTGCCACACTCTCTGGGTGTGG No data
1173999344_1173999350 24 Left 1173999344 20:47362949-47362971 CCCACATCAAGAAGCACAACTGT No data
Right 1173999350 20:47362996-47363018 GGTGCCACACTCTCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173999350 Original CRISPR GGTGCCACACTCTCTGGGTG TGG Intergenic
No off target data available for this crispr